cell mask deep red plasma membrane dye Search Results


96
ATCC p815 plasmacytoma
P815 Plasmacytoma, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/p815 plasmacytoma/product/ATCC
Average 96 stars, based on 1 article reviews
p815 plasmacytoma - by Bioz Stars, 2026-06
96/100 stars
  Buy from Supplier

98
Vector Laboratories v5280 vectashield antifade mounting medium
V5280 Vectashield Antifade Mounting Medium, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/v5280 vectashield antifade mounting medium/product/Vector Laboratories
Average 98 stars, based on 1 article reviews
v5280 vectashield antifade mounting medium - by Bioz Stars, 2026-06
98/100 stars
  Buy from Supplier

93
Addgene inc mouse igf2bp3
A Growth curves of AML cell lines grown in complete medium (CM) or equivalent medium lacking serine and glycine (-SG). B Mouse HSPCs were transduced with MLL-AF9 ( MA9 ) retroviruses, followed by cultured in CM or -SG progenitor medium for 2 days. The cells were then plated into mouse methylcellulose medium for CFA. Colony numbers and representative photos of colonies are shown. Bar = 200 μm. C A schematic diagram, created from GDP ( https://BioGDP.com , Agreement number: GDP2025UWV74M), depicting the CRISPR/Cas9-based screening strategy. Lentivirus-transduced Molm13 Cas9 cells were selected with puromycin for 5 days and collected for an initial gDNA sample (denoted as T0). Cells were further grown in CM or -SG medium for 8, 12, or 17 population doublings, and were denoted as P8, P12, or P17, respectively. For each gene, we calculated its gene score as the mean log 2 fold change (LFC) in the abundance of all the sgRNAs targeting the corresponding gene in different population doublings compared to T0. The SG-dependent score refers to the difference in gene scores in the absence versus presence of SG at the same population doubling. D The SG-dependent scores of the top 30 genes from the screening in ( C ), with the m 6 A regulatory genes <t>IGF2BP3</t> and METTL14 being highlighted in red and purple, respectively. E , F The normalized abundance of the 12 sgRNAs targeting IGF2BP3 ( E ) or METTL14 ( F ) from cells cultured in CM or -SG medium and collected at P8, P12, and P17. The definition of data points is same as in ( C ). n = 12 sgRNAs. The boxes extend from the 25th to the 75th percentiles, with a distinct line marking the median. Whiskers extend to the maximum and minimum data points. G Growth curves of Molm13 Cas9 transduced with control sgRNA (sgNS) or IGF2BP3 sgRNA (sgBP3) and grown in CM or -SG medium. H Growth curves of control or IGF2BP3 KD cells in CM or -SG medium. I Growth curves of control or METTL14 KD Molm13 cells in CM or -SG medium. J Schematic illustration showing the AID2 system in inducing rapid degradation of IGF2BP3 protein. K Relative growth of IGF2BP3-mAID (clone BP3-mAID cells) cells in CM or -SG medium with or without treatment with 5’Ph-IAA (IAA) for 24 h. Mean ± SD values are shown. n = 2 biologically independent repeats in ( A , B , G , H , I , and K ). Source data are provided as a Source Data file.
Mouse Igf2bp3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse igf2bp3/product/Addgene inc
Average 93 stars, based on 1 article reviews
mouse igf2bp3 - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

94
OriGene prs 15 lox 1 shrna 83 vector
Effects of <t>15-LOX-1</t> downregulation on terminal cell differentiation, tight junction formation, and E-cadherin membrane localization in colon cells. Caco-2 wild-type (WT) cells and clones of 15-LOX-1 shRNA stably transfected Caco-2 cells with either successful [15-LOX-1 KD (+)] or unsuccessful [15-LOX-1 KD (−)] 15-LOX-1 knockdown were treated with sodium butyrate (NaBT) for 48 hours and then harvested and processed for 15-LOX-1 expression by Western blotting (Fig. 5A) and alkaline phosphatase enzymatic activity as a marker of cell differentiation (Fig. 5B). Values are the means and standard errors of the means of triplicate measurements. * P < 0.0001 (two-way analysis of variance). Positive control in A is cell lysate protein extract from HCT-116 cells transfected with a 15-LOX-1 expression vector. C, 15-LOX-1 KD (+) and 15-LOX-1 KD (−) cells were cultured for 14 days after confluence. 15-LOX-1 mRNA levels were measured by quantitative real-time reverse transcription-polymerase chain reaction on days 0 and 14 after confluence. Values are the means and standard errors of the means of triplicate measurements. * P < 0.0001 (two-way analysis of variance). D, 15-LOX-1 KD (+) and 15-LOX-1 KD (−) cells were evaluated for tight junction formation using FITC-dextran fluorescence permeability assay on day 14 after confluence. Relative fluorescence intensity values (relative to that of wild-type Caco-2 cells) at various time points are shown. Values are the means and standard errors of the means of triplicate measurements of three experiments. * P < 0.008 (t-test). E, 15-LOX-1 KD (+) and 15-LOX-1 KD (−) cells were cultured for the indicated numbers of days after confluence. Equal protein amounts from cytoskeleton-associated (insoluble) and total cell lysates were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis separation followed by Western blotting. Band intensities (lower panel) for the blotted E-cadherin were quantified using an Odyssey fluorescent imager (LI-COR Biosciences, Lincoln, NE) and Odyssey software.
Prs 15 Lox 1 Shrna 83 Vector, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/prs 15 lox 1 shrna 83 vector/product/OriGene
Average 94 stars, based on 1 article reviews
prs 15 lox 1 shrna 83 vector - by Bioz Stars, 2026-06
94/100 stars
  Buy from Supplier

94
Genecopoeia human spg11
(A) A protein interaction network of <t>SPG11</t> illustrating novel protein interactors identified by mass spectrometry in this study (orange edges), literature-derived protein interactors from PINOT and BioPlex 3.0 (blue edges), and an interactor common to both our novel dataset and literature-derived data (green edge). The edge thickness positively correlates with protein interaction confidence based on distinct method detection strategies used and the number of specific documented reports. (B) The subcellular localisation of the interactors resulted from our AP/MS analysis and of SPG11 is visualised, with each colour corresponding to a different location block. The collection of subcellular location data in the form of Gene Ontology cellular component terms was performed through AmiGO and the grouping of each term into location blocks with an in-house grouping protocol.
Human Spg11, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human spg11/product/Genecopoeia
Average 94 stars, based on 1 article reviews
human spg11 - by Bioz Stars, 2026-06
94/100 stars
  Buy from Supplier

96
Vector Biolabs ad gfp
3D rendering (A) and average values of 18F-Fluciclovine uptake (B) in ~10–12-week-old male CON and LrpprcBKO mice. White cycle: BAT. Sample size: CON (n=9) and LrpprcBKO (n=8). (C) Left: Immunoblots of p-S6, total S6, p-4Ebp1, total 4Ebp1, puromycylated protein, ubiquitinated protein and Hsp90 in the BAT of ~10-week-old male CON and ATF4BOX mice at ad libitum feeding at RT and 30°C. Right: Relative abundance (to Hsp90) or phosphorylation (to total protein) shown. Significance between genotypes indicated. (D) Core temperature drop of ~10-week-old male and female LrpprcBKO mice and their relative controls with pretreatment of DMSO, or 4mg kg−1 rapamycin (RAPA), or 0.625mg kg−1 bortezomib (BORT), or 50mg kg−1 BCH after 8 hours 4°C CTT from RT. Sample size: CON/RT/DMSO (n=9), LrpprcBKO/RT/DMSO (n=10), CON/RT/RAPA (n=6), LrpprcBKO/RT/RAPA (n=7), CON/RT/BORT (n=4), LrpprcBKO/RT/BORT (n=4), CON/RT/BCH (n=8) and LrpprcBKO/RT/BCH (n=5). (E) Core temperature drop of ~10-week-old male and female CON and ATF4BOX mice with pretreatment of DMSO or RAPA or BORT or BCH after 3 hours 4°C CTT from 30°C. Sample size: CON/30°C/DMSO (n=14), ATF4BOX/30°C/DMSO (n=14), CON/30°C/RAPA (n=5), ATF4BOX/30°C/RAPA (n=8), CON/30°C/BORT (n=5), ATF4BOX/30°C/BORT (n=7), CON/30°C/BCH (n=4) and ATF4BOX/30°C/BCH (n=9). (F) Core temperature drop of ~10-week-old male and female Ucp1 KO and ATF4BOX;Ucp1 KO mice with pretreatment of DMSO or RAPA or BORT or BCH after 3 hours 4°C CTT from RT. Sample size: Ucp1 KO/RT/DMSO (n=5), ATF4BOX;Ucp1 KO/RT/DMSO (n=3), Ucp1 KO/RT/RAPA (n=10), ATF4BOX;Ucp1 KO/RT/RAPA (n=5), Ucp1 KO/RT/BORT (n=4), ATF4BOX;Ucp1 KO/RT/BORT (n=4), Ucp1 KO/RT/BCH (n=5) and ATF4BOX;Ucp1 KO/RT/BCH (n=5). (G) The Temp (Neck-Back) of ~12-week-old male and female CON and LrpprcBKO mice 2 hours after injections of RAPA or BORT or DMSO at thermoneutrality. Sample size: CON (n=6) and LrpprcBKO (n=11). (H) The Temp (Neck-Back) of ~12-week-old male and female CON and ATF4BOX mice 2 hours after injections of RAPA or BORT or DMSO at thermoneutrality. Sample size: CON (n=7) and ATF4BOX (n=8). (I) The Temp (Neck-Back) of ~12-week-old male and female Ucp1 KO and ATF4BOX;Ucp1 KO mice 2 hours after injections of RAPA or BORT or DMSO at thermoneutrality. Sample size: Ucp1 KO (n=6) and ATF4BOX;Ucp1 KO (n=9). (J) Experimental setup of pSILAC in ATF4-expressing differentiated BAs. BAT SVF cells from ROSA-LSL-ATF4 or ROSA-LSL-ATF4;Ucp1 KO mice were cultured and differentiated in vitro. Four days after differentiation, <t>GFP</t> or <t>Cre</t> <t>adenovirus</t> were added at 100 MOI for two days. Cells were cultured in light medium from day 0 to 8, then transferred to heavy medium up to one day. Cells were collected at indicated time points for expression and mass spectrometry analyses. (K) Left: Immunoblots of Ucp1, Flag-ATF4, p-S6, total S6, p-4Ebp1, total 4Ebp1, puromycylated protein, ubiquitinated protein and Hsp90 in GFP or Cre-treated wild-type or Ucp1 KO BAs. Right: Relative abundance (to Hsp90) or phosphorylation (to total protein) shown. Significance between genotypes indicated. (L) Left: Immunoblots of Flag-ATF4, total ATF4, p-S6, total S6, p-4Ebp1, total 4Ebp1, puromycylated protein, ubiquitinated protein and Hsp90 in GFP or Cre-treated wild-type BAs after 4-hour treatment of 10 mM BCH or DMSO. Right: Relative abundance (to Hsp90) or phosphorylation (to total protein) shown. Significance between genotypes and treatment indicated. Data were presented as average ± SEM. Unpaired t-test. n.s.: non-significant; *: p<0.05 and **: p<0.01. (M) Box plot showing the fraction of heavy labeled over total protein in the GFP- or Cre-infected BAs in either wild-type (WT) or Ucp1 KO background at 6, 12, 24 hours post heavy medium switch. Welch’s 2-sided t-test performed. (N) Volcano plots showing the changes of H/L ratio between Cre- and GFP-infected BAs (X axis) and −log10 p value (Y axis) at 24-hour timepoint in WT and Ucp1 KO background. Grey box: proteins with higher turnover after ATF4-overexpression.
Ad Gfp, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ad gfp/product/Vector Biolabs
Average 96 stars, based on 1 article reviews
ad gfp - by Bioz Stars, 2026-06
96/100 stars
  Buy from Supplier

94
Vector Laboratories serum normal orse serum for tryptase and rabbit serum for chymase ectastain elite kit vector laboratories burlingame cal fornia
3D rendering (A) and average values of 18F-Fluciclovine uptake (B) in ~10–12-week-old male CON and LrpprcBKO mice. White cycle: BAT. Sample size: CON (n=9) and LrpprcBKO (n=8). (C) Left: Immunoblots of p-S6, total S6, p-4Ebp1, total 4Ebp1, puromycylated protein, ubiquitinated protein and Hsp90 in the BAT of ~10-week-old male CON and ATF4BOX mice at ad libitum feeding at RT and 30°C. Right: Relative abundance (to Hsp90) or phosphorylation (to total protein) shown. Significance between genotypes indicated. (D) Core temperature drop of ~10-week-old male and female LrpprcBKO mice and their relative controls with pretreatment of DMSO, or 4mg kg−1 rapamycin (RAPA), or 0.625mg kg−1 bortezomib (BORT), or 50mg kg−1 BCH after 8 hours 4°C CTT from RT. Sample size: CON/RT/DMSO (n=9), LrpprcBKO/RT/DMSO (n=10), CON/RT/RAPA (n=6), LrpprcBKO/RT/RAPA (n=7), CON/RT/BORT (n=4), LrpprcBKO/RT/BORT (n=4), CON/RT/BCH (n=8) and LrpprcBKO/RT/BCH (n=5). (E) Core temperature drop of ~10-week-old male and female CON and ATF4BOX mice with pretreatment of DMSO or RAPA or BORT or BCH after 3 hours 4°C CTT from 30°C. Sample size: CON/30°C/DMSO (n=14), ATF4BOX/30°C/DMSO (n=14), CON/30°C/RAPA (n=5), ATF4BOX/30°C/RAPA (n=8), CON/30°C/BORT (n=5), ATF4BOX/30°C/BORT (n=7), CON/30°C/BCH (n=4) and ATF4BOX/30°C/BCH (n=9). (F) Core temperature drop of ~10-week-old male and female Ucp1 KO and ATF4BOX;Ucp1 KO mice with pretreatment of DMSO or RAPA or BORT or BCH after 3 hours 4°C CTT from RT. Sample size: Ucp1 KO/RT/DMSO (n=5), ATF4BOX;Ucp1 KO/RT/DMSO (n=3), Ucp1 KO/RT/RAPA (n=10), ATF4BOX;Ucp1 KO/RT/RAPA (n=5), Ucp1 KO/RT/BORT (n=4), ATF4BOX;Ucp1 KO/RT/BORT (n=4), Ucp1 KO/RT/BCH (n=5) and ATF4BOX;Ucp1 KO/RT/BCH (n=5). (G) The Temp (Neck-Back) of ~12-week-old male and female CON and LrpprcBKO mice 2 hours after injections of RAPA or BORT or DMSO at thermoneutrality. Sample size: CON (n=6) and LrpprcBKO (n=11). (H) The Temp (Neck-Back) of ~12-week-old male and female CON and ATF4BOX mice 2 hours after injections of RAPA or BORT or DMSO at thermoneutrality. Sample size: CON (n=7) and ATF4BOX (n=8). (I) The Temp (Neck-Back) of ~12-week-old male and female Ucp1 KO and ATF4BOX;Ucp1 KO mice 2 hours after injections of RAPA or BORT or DMSO at thermoneutrality. Sample size: Ucp1 KO (n=6) and ATF4BOX;Ucp1 KO (n=9). (J) Experimental setup of pSILAC in ATF4-expressing differentiated BAs. BAT SVF cells from ROSA-LSL-ATF4 or ROSA-LSL-ATF4;Ucp1 KO mice were cultured and differentiated in vitro. Four days after differentiation, <t>GFP</t> or <t>Cre</t> <t>adenovirus</t> were added at 100 MOI for two days. Cells were cultured in light medium from day 0 to 8, then transferred to heavy medium up to one day. Cells were collected at indicated time points for expression and mass spectrometry analyses. (K) Left: Immunoblots of Ucp1, Flag-ATF4, p-S6, total S6, p-4Ebp1, total 4Ebp1, puromycylated protein, ubiquitinated protein and Hsp90 in GFP or Cre-treated wild-type or Ucp1 KO BAs. Right: Relative abundance (to Hsp90) or phosphorylation (to total protein) shown. Significance between genotypes indicated. (L) Left: Immunoblots of Flag-ATF4, total ATF4, p-S6, total S6, p-4Ebp1, total 4Ebp1, puromycylated protein, ubiquitinated protein and Hsp90 in GFP or Cre-treated wild-type BAs after 4-hour treatment of 10 mM BCH or DMSO. Right: Relative abundance (to Hsp90) or phosphorylation (to total protein) shown. Significance between genotypes and treatment indicated. Data were presented as average ± SEM. Unpaired t-test. n.s.: non-significant; *: p<0.05 and **: p<0.01. (M) Box plot showing the fraction of heavy labeled over total protein in the GFP- or Cre-infected BAs in either wild-type (WT) or Ucp1 KO background at 6, 12, 24 hours post heavy medium switch. Welch’s 2-sided t-test performed. (N) Volcano plots showing the changes of H/L ratio between Cre- and GFP-infected BAs (X axis) and −log10 p value (Y axis) at 24-hour timepoint in WT and Ucp1 KO background. Grey box: proteins with higher turnover after ATF4-overexpression.
Serum Normal Orse Serum For Tryptase And Rabbit Serum For Chymase Ectastain Elite Kit Vector Laboratories Burlingame Cal Fornia, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/serum normal orse serum for tryptase and rabbit serum for chymase ectastain elite kit vector laboratories burlingame cal fornia/product/Vector Laboratories
Average 94 stars, based on 1 article reviews
serum normal orse serum for tryptase and rabbit serum for chymase ectastain elite kit vector laboratories burlingame cal fornia - by Bioz Stars, 2026-06
94/100 stars
  Buy from Supplier

91
Thermo Fisher gene exp atp2b2 hs01090447 m1
(A) Live cell confocal images in SKBR3 cells expressing LCK-GCaMP at physiologic calcium (control) or treated with 10 mM extracellular calcium + 10 μM ionomycin. (B) Live cell confocal images in control and MAL2KD_SKBR3 cells expressing LCK-GCaMP. (C) Live cell confocal images in control and MβCD-treated SKBR3 cells expressing LCK-GCaM. (D) <t>PMCA2</t> mRNA expression in control, MAL2KD-treated, or MβCD-treated SKBR3 cells as assessed by quantitative RT-PCR (n = 3). (E) Western blot analysis of PMCA2 protein levels in control, MAL2KD-treated, or MβCD-treated SKBR3 cells. (F) PLA with immunofluorescence for phalloidin in HER2 and PMCA2 in control (top row), MAL2KD-treated (middle row), and MβCD-treated (bottom row) SKBR3 cells. Scale bars represent 10 μm. (G) PLA for HER2 and GFP-PMCA2 with immunofluorescence for GFP-labeled PMCA2 and actin (phalloidin) in control (top row), MAL2KD-treated (middle row), and MβCD-treated (bottom row) SKBR3 cells. (H) Quantitation of PLA experiment from (F) and (G) by measuring the fluorescent intensity of amplified PLA reactions at the plasma membrane. (I) SIM imaging showing HER2- and GFP-labeled PMCA2 in control, MAL2KD-treated, and MβCD-treated SKBR3 cells. Scale bars represent 10 μm. (J) Apoptosis, as assessed by TUNEL assay, in MAL2KD cells relative to controls exposed to 5 mM calcium ± ionomycin. These results are the representative of three independent experiments.
Gene Exp Atp2b2 Hs01090447 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp atp2b2 hs01090447 m1/product/Thermo Fisher
Average 91 stars, based on 1 article reviews
gene exp atp2b2 hs01090447 m1 - by Bioz Stars, 2026-06
91/100 stars
  Buy from Supplier

99
Vector Laboratories vectastain elite abc kit

Vectastain Elite Abc Kit, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/vectastain elite abc kit/product/Vector Laboratories
Average 99 stars, based on 1 article reviews
vectastain elite abc kit - by Bioz Stars, 2026-06
99/100 stars
  Buy from Supplier

90
Mayo Medical Laboratories cell dynamic reaction cell-inductively coupled plasma-mass spectrometry

Cell Dynamic Reaction Cell Inductively Coupled Plasma Mass Spectrometry, supplied by Mayo Medical Laboratories, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cell dynamic reaction cell-inductively coupled plasma-mass spectrometry/product/Mayo Medical Laboratories
Average 90 stars, based on 1 article reviews
cell dynamic reaction cell-inductively coupled plasma-mass spectrometry - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

95
Vector Laboratories gna
Immunosuppressive drugs alter the surface expression of high-mannose/hybrid N-glycans. Peripheral blood mononuclear cells were cultured for 6 days in the presence of CsA (200 ng per 1 mL medium), Rapa (20 ng per 1 mL medium), and the combination of CsA (150 ng per 1 mL medium) and Rapa (12 ng per 1 mL medium) in a two-way mixed leukocyte reaction (MLR). Immunosuppressive drug-treated and control cells were stained <t>with</t> <t>biotinylated</t> <t>GNA</t> (1 : 100), followed by incubation with FITC-conjugated ExtrAvidin. M2 region corresponds to GNA-positive leukocytes after allostimulation. Fluorescence was measured using a FACSCalibur flow cytometer (BD Biosciences). C: untreated cells, CsA: cyclosporin A, and Rapa: rapamycin.
Gna, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gna/product/Vector Laboratories
Average 95 stars, based on 1 article reviews
gna - by Bioz Stars, 2026-06
95/100 stars
  Buy from Supplier

96
Invent Biotechnologies plasma membrane protein isolation kit
sClever-1 is truncated at the C-terminus and released by serine protease activity. A-B , Electron microscopy images of immunogold labelling of Clever-1 in KG-1 cells showing outward <t>membrane</t> budding (A) and a tunneling nanotube-like structure (B) between two cells. Arrows point to gold particles. C-D , Western blot showing sClever-1 in conditioned media of PMA-differentiated KG-1 cells after 24 h inhibitor treatments: (E) bafilomycin (Baf), concanamycin (Con), GW4896 (GW), P1860, marimastat (Mari), untreated (Ctrl), bexmarilimab (Bex), and isotype control (hIgG4); (F) leupeptin (Leu), Bestatin (Bes), aprotinin (Apr), pepstatin A (Pep A), SID 26681509 (SID), CA-074 and E-64. E , Quantification (ELISA) of sClever-1 in vesicle fractions in KG-1 cell culture supernatant, blood and lymph separated by ultracentrifugation. Samples were normalized to 1 µg/µL of <t>protein.</t> The graphs represent one independent assay with three technical replicates. F , Western blot analysis of sClever-1 detected with 3-372 mouse anti-human Clever-1 antibody (parent of Bex) in vesicle and liquid fractions of <t>plasma</t> and cell culture supernatants of primary human macrophages (M0, no polarization; M1, IFNγ + LPS; M2, IL-4 + dexamethasone), endothelial cells (HLEC, human lymphatic endothelial cells; HPMEC, human pulmonary microvascular endothelial cells) and cell lines (KG-1 with/without PMA and HEK293). Equal loading of 10 µg of protein sample per lane was ensured by Qubit measurement of protein concentration. G , Western blot showing the abundance of a ~200 kDa sClever-1 species in healthy donors (n = 3) and MATINS patients (n = 4). # denotes the vesicle fraction. CD63 was used as a loading control. H , Mass spec analysis of Coomassie stained bands immunoprecipitated from human serum with Bex or 9-11 anti-Clever-1 antibodies and relative isotype controls hIgG4 and rIgG2a, respectively. The cartoons show Clever-1-specific peptide hits mapped to the full-length Clever-1 protein for Bex (orange) and 9-11 (magenta) pulldown. Venn diagrams depict shared peptides identified by Bex and 9-11.
Plasma Membrane Protein Isolation Kit, supplied by Invent Biotechnologies, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plasma membrane protein isolation kit/product/Invent Biotechnologies
Average 96 stars, based on 1 article reviews
plasma membrane protein isolation kit - by Bioz Stars, 2026-06
96/100 stars
  Buy from Supplier

Image Search Results


A Growth curves of AML cell lines grown in complete medium (CM) or equivalent medium lacking serine and glycine (-SG). B Mouse HSPCs were transduced with MLL-AF9 ( MA9 ) retroviruses, followed by cultured in CM or -SG progenitor medium for 2 days. The cells were then plated into mouse methylcellulose medium for CFA. Colony numbers and representative photos of colonies are shown. Bar = 200 μm. C A schematic diagram, created from GDP ( https://BioGDP.com , Agreement number: GDP2025UWV74M), depicting the CRISPR/Cas9-based screening strategy. Lentivirus-transduced Molm13 Cas9 cells were selected with puromycin for 5 days and collected for an initial gDNA sample (denoted as T0). Cells were further grown in CM or -SG medium for 8, 12, or 17 population doublings, and were denoted as P8, P12, or P17, respectively. For each gene, we calculated its gene score as the mean log 2 fold change (LFC) in the abundance of all the sgRNAs targeting the corresponding gene in different population doublings compared to T0. The SG-dependent score refers to the difference in gene scores in the absence versus presence of SG at the same population doubling. D The SG-dependent scores of the top 30 genes from the screening in ( C ), with the m 6 A regulatory genes IGF2BP3 and METTL14 being highlighted in red and purple, respectively. E , F The normalized abundance of the 12 sgRNAs targeting IGF2BP3 ( E ) or METTL14 ( F ) from cells cultured in CM or -SG medium and collected at P8, P12, and P17. The definition of data points is same as in ( C ). n = 12 sgRNAs. The boxes extend from the 25th to the 75th percentiles, with a distinct line marking the median. Whiskers extend to the maximum and minimum data points. G Growth curves of Molm13 Cas9 transduced with control sgRNA (sgNS) or IGF2BP3 sgRNA (sgBP3) and grown in CM or -SG medium. H Growth curves of control or IGF2BP3 KD cells in CM or -SG medium. I Growth curves of control or METTL14 KD Molm13 cells in CM or -SG medium. J Schematic illustration showing the AID2 system in inducing rapid degradation of IGF2BP3 protein. K Relative growth of IGF2BP3-mAID (clone BP3-mAID cells) cells in CM or -SG medium with or without treatment with 5’Ph-IAA (IAA) for 24 h. Mean ± SD values are shown. n = 2 biologically independent repeats in ( A , B , G , H , I , and K ). Source data are provided as a Source Data file.

Journal: Nature Communications

Article Title: m 6 A/IGF2BP3-driven serine biosynthesis fuels AML stemness and metabolic vulnerability

doi: 10.1038/s41467-025-58966-1

Figure Lengend Snippet: A Growth curves of AML cell lines grown in complete medium (CM) or equivalent medium lacking serine and glycine (-SG). B Mouse HSPCs were transduced with MLL-AF9 ( MA9 ) retroviruses, followed by cultured in CM or -SG progenitor medium for 2 days. The cells were then plated into mouse methylcellulose medium for CFA. Colony numbers and representative photos of colonies are shown. Bar = 200 μm. C A schematic diagram, created from GDP ( https://BioGDP.com , Agreement number: GDP2025UWV74M), depicting the CRISPR/Cas9-based screening strategy. Lentivirus-transduced Molm13 Cas9 cells were selected with puromycin for 5 days and collected for an initial gDNA sample (denoted as T0). Cells were further grown in CM or -SG medium for 8, 12, or 17 population doublings, and were denoted as P8, P12, or P17, respectively. For each gene, we calculated its gene score as the mean log 2 fold change (LFC) in the abundance of all the sgRNAs targeting the corresponding gene in different population doublings compared to T0. The SG-dependent score refers to the difference in gene scores in the absence versus presence of SG at the same population doubling. D The SG-dependent scores of the top 30 genes from the screening in ( C ), with the m 6 A regulatory genes IGF2BP3 and METTL14 being highlighted in red and purple, respectively. E , F The normalized abundance of the 12 sgRNAs targeting IGF2BP3 ( E ) or METTL14 ( F ) from cells cultured in CM or -SG medium and collected at P8, P12, and P17. The definition of data points is same as in ( C ). n = 12 sgRNAs. The boxes extend from the 25th to the 75th percentiles, with a distinct line marking the median. Whiskers extend to the maximum and minimum data points. G Growth curves of Molm13 Cas9 transduced with control sgRNA (sgNS) or IGF2BP3 sgRNA (sgBP3) and grown in CM or -SG medium. H Growth curves of control or IGF2BP3 KD cells in CM or -SG medium. I Growth curves of control or METTL14 KD Molm13 cells in CM or -SG medium. J Schematic illustration showing the AID2 system in inducing rapid degradation of IGF2BP3 protein. K Relative growth of IGF2BP3-mAID (clone BP3-mAID cells) cells in CM or -SG medium with or without treatment with 5’Ph-IAA (IAA) for 24 h. Mean ± SD values are shown. n = 2 biologically independent repeats in ( A , B , G , H , I , and K ). Source data are provided as a Source Data file.

Article Snippet: Human ATF4 , PHGDH and PSAT1 coding sequences were reverse-transcribed and PCR amplified from total RNA of Molm13, and subcloned into the cl20c-N-2×FLAG-GFP lentiviral vector. shRNA vectors targeting human or mouse IGF2BP3 , ATF4 , PHGDH , and PSAT1 were constructed by synthesizing shRNA-encoded DNA oligos and cloning them into the pLKO.1 vector (Addgene).

Techniques: Transduction, Cell Culture, CRISPR, Control

A Bubble diagram showing the enrichment of metabolic pathways by the C 13 -labeled metabolites with reduced levels after IGF2BP3 KD in Molm13 cells. B Heatmaps showing levels of representative C 13 -labeled metabolites after IGF2BP3 KD in Molm13 cells. C The total levels and isotopolog distribution ( M + n , n refers to numbers of 13 C) of purines measured by LC-MS in Molm13 cells transduced with IGF2BP3 shRNAs or shNS and grown in medium containing U-[ 13 C]-glucose. D Schematic of the serine synthesis pathway and its downstream pathways. E The levels of C 13 -labeled serine ( M + 3) were measured by LC-MS in Molm13 cells transduced with IGF2BP3 shRNAs or shNS and grown in medium containing U-[ 13 C]-glucose. F – H Intracellular serine level measured by fluorescence-based serine detection assays in Molm13 cells transduced with shRNAs ( F ) or sgRNAs ( G ) targeting IGF2BP3 or shRNAs targeting METTL14 ( H ), compared to those with negative control (shNS). I The Venn diagram showing the overlap of significantly downregulated genes (adjusted P < 0.05, fold change <0.67) in Molm13 cells with IGF2BP3 KD, as well as in U937 BP3-mAID cells treated with 5’Ph-IAA for 6 or 24 h to induce degradation of the IGF2BP3 protein. J Pie chart showing numbers of transcripts with or without m 6 A modifications among the 61 overlapping genes in ( H ), and heatmap showing expression changes of the 48 m 6 A-containing transcripts in IGF2BP3 KD Molm13 cells or IGF2BP3-depleted U937 cells. K GO enrichment analysis of the 48 candidate targets of IGF2BP3 in ( I ). The degrees of interactions were generated by STRING. Mean ± SD values are shown. n = 2 biologically independent repeats in ( C ) and ( E ), while n = 3 biologically independent repeats in ( F – H ). P -values were calculated with one-sided Hypergeometric test ( A , K ); two-tailed Wald test adjusted with Benjamini-Hochberg Procedure ( I ); two-tailed student’s t -test ( F – H ); Source data are provided as a Source Data file.

Journal: Nature Communications

Article Title: m 6 A/IGF2BP3-driven serine biosynthesis fuels AML stemness and metabolic vulnerability

doi: 10.1038/s41467-025-58966-1

Figure Lengend Snippet: A Bubble diagram showing the enrichment of metabolic pathways by the C 13 -labeled metabolites with reduced levels after IGF2BP3 KD in Molm13 cells. B Heatmaps showing levels of representative C 13 -labeled metabolites after IGF2BP3 KD in Molm13 cells. C The total levels and isotopolog distribution ( M + n , n refers to numbers of 13 C) of purines measured by LC-MS in Molm13 cells transduced with IGF2BP3 shRNAs or shNS and grown in medium containing U-[ 13 C]-glucose. D Schematic of the serine synthesis pathway and its downstream pathways. E The levels of C 13 -labeled serine ( M + 3) were measured by LC-MS in Molm13 cells transduced with IGF2BP3 shRNAs or shNS and grown in medium containing U-[ 13 C]-glucose. F – H Intracellular serine level measured by fluorescence-based serine detection assays in Molm13 cells transduced with shRNAs ( F ) or sgRNAs ( G ) targeting IGF2BP3 or shRNAs targeting METTL14 ( H ), compared to those with negative control (shNS). I The Venn diagram showing the overlap of significantly downregulated genes (adjusted P < 0.05, fold change <0.67) in Molm13 cells with IGF2BP3 KD, as well as in U937 BP3-mAID cells treated with 5’Ph-IAA for 6 or 24 h to induce degradation of the IGF2BP3 protein. J Pie chart showing numbers of transcripts with or without m 6 A modifications among the 61 overlapping genes in ( H ), and heatmap showing expression changes of the 48 m 6 A-containing transcripts in IGF2BP3 KD Molm13 cells or IGF2BP3-depleted U937 cells. K GO enrichment analysis of the 48 candidate targets of IGF2BP3 in ( I ). The degrees of interactions were generated by STRING. Mean ± SD values are shown. n = 2 biologically independent repeats in ( C ) and ( E ), while n = 3 biologically independent repeats in ( F – H ). P -values were calculated with one-sided Hypergeometric test ( A , K ); two-tailed Wald test adjusted with Benjamini-Hochberg Procedure ( I ); two-tailed student’s t -test ( F – H ); Source data are provided as a Source Data file.

Article Snippet: Human ATF4 , PHGDH and PSAT1 coding sequences were reverse-transcribed and PCR amplified from total RNA of Molm13, and subcloned into the cl20c-N-2×FLAG-GFP lentiviral vector. shRNA vectors targeting human or mouse IGF2BP3 , ATF4 , PHGDH , and PSAT1 were constructed by synthesizing shRNA-encoded DNA oligos and cloning them into the pLKO.1 vector (Addgene).

Techniques: Labeling, Liquid Chromatography with Mass Spectroscopy, Transduction, Fluorescence, Negative Control, Expressing, Generated, Two Tailed Test

A Western blot after IGF2BP3 KD in various AML cell lines. GAPDH was used as a loading control. B Western blot of U937 BP3-mAID cells after treatment with 5’Ph-IAA for the indicated time periods. ACTB was used as a loading control. C Western blot of Molm13 cells after overexpression of wild-type (BP3-WT) or KH3-4 mutated (BP3-KH34) IGF2BP3. D Western blot of Molm13 cells after METTL14 KD. E IGV tracks showing the distribution of m 6 A (GEO: GSE97408 ) or IGF2BP3 binding sites (GEO: GSE90639 ) in target mRNAs. Gray shadow depicts high-confidence m 6 A regions for qPCR validation in ( G ) and ( H ). F RIP assays using an IGF2BP3 antibody were performed in Molm13 cells, followed by qPCR to detect direct binding of IGF2BP3 to target mRNAs at regions indicated in ( E ). G MeRIP-qPCR was performed in control and METTL14 KD Molm13 cells to detect the change of m 6 A abundance at indicated regions of ATF4 , PHGDH , and PSAT1 transcripts. H Bst DNA polymerase-mediated cDNA extension and qPCR assays to evaluate relative m 6 A abundance changes at specific sites within ATF4 , PHGDH , and PSAT1 transcripts in control and METTL14 KD Molm13 cells. I Control and IGF2BP3 KD Molm13 cells were treated with actinomycin D for indicated time periods and the RNA level of target genes was examined by qPCR. 18S rRNA was used as a loading control. The mRNA half-life ( t 1/2 ) was calculated and shown. ( J , K ) Live cell counting ( J ) and cytometric analysis of Annexin V + apoptotic cells ( K ) in Molm13 cells upon IGF2BP3 KD and ATF4, PHGDH, or PSAT1 overexpression. EV, empty vector. ( L , M ) Molm13 cells were co-transduced with control or IGF2BP3 shRNAs and ATF4/PHGDH/PSAT1 overexpression vectors and subjected to colony-forming assays ( L ) and serine level detection ( M ). Representative results from one of the two independent experiments were shown ( A – D ). Mean ± SD values are shown. n = 3 biologically independent repeats in ( F , G , H , I , K , and M ), while n = 2 biologically independent repeats in ( J ) and ( L ). Two-tailed student’s t -test ( F – H ), two-way ANOVA ( K , M ). Source data are provided as a Source Data file.

Journal: Nature Communications

Article Title: m 6 A/IGF2BP3-driven serine biosynthesis fuels AML stemness and metabolic vulnerability

doi: 10.1038/s41467-025-58966-1

Figure Lengend Snippet: A Western blot after IGF2BP3 KD in various AML cell lines. GAPDH was used as a loading control. B Western blot of U937 BP3-mAID cells after treatment with 5’Ph-IAA for the indicated time periods. ACTB was used as a loading control. C Western blot of Molm13 cells after overexpression of wild-type (BP3-WT) or KH3-4 mutated (BP3-KH34) IGF2BP3. D Western blot of Molm13 cells after METTL14 KD. E IGV tracks showing the distribution of m 6 A (GEO: GSE97408 ) or IGF2BP3 binding sites (GEO: GSE90639 ) in target mRNAs. Gray shadow depicts high-confidence m 6 A regions for qPCR validation in ( G ) and ( H ). F RIP assays using an IGF2BP3 antibody were performed in Molm13 cells, followed by qPCR to detect direct binding of IGF2BP3 to target mRNAs at regions indicated in ( E ). G MeRIP-qPCR was performed in control and METTL14 KD Molm13 cells to detect the change of m 6 A abundance at indicated regions of ATF4 , PHGDH , and PSAT1 transcripts. H Bst DNA polymerase-mediated cDNA extension and qPCR assays to evaluate relative m 6 A abundance changes at specific sites within ATF4 , PHGDH , and PSAT1 transcripts in control and METTL14 KD Molm13 cells. I Control and IGF2BP3 KD Molm13 cells were treated with actinomycin D for indicated time periods and the RNA level of target genes was examined by qPCR. 18S rRNA was used as a loading control. The mRNA half-life ( t 1/2 ) was calculated and shown. ( J , K ) Live cell counting ( J ) and cytometric analysis of Annexin V + apoptotic cells ( K ) in Molm13 cells upon IGF2BP3 KD and ATF4, PHGDH, or PSAT1 overexpression. EV, empty vector. ( L , M ) Molm13 cells were co-transduced with control or IGF2BP3 shRNAs and ATF4/PHGDH/PSAT1 overexpression vectors and subjected to colony-forming assays ( L ) and serine level detection ( M ). Representative results from one of the two independent experiments were shown ( A – D ). Mean ± SD values are shown. n = 3 biologically independent repeats in ( F , G , H , I , K , and M ), while n = 2 biologically independent repeats in ( J ) and ( L ). Two-tailed student’s t -test ( F – H ), two-way ANOVA ( K , M ). Source data are provided as a Source Data file.

Article Snippet: Human ATF4 , PHGDH and PSAT1 coding sequences were reverse-transcribed and PCR amplified from total RNA of Molm13, and subcloned into the cl20c-N-2×FLAG-GFP lentiviral vector. shRNA vectors targeting human or mouse IGF2BP3 , ATF4 , PHGDH , and PSAT1 were constructed by synthesizing shRNA-encoded DNA oligos and cloning them into the pLKO.1 vector (Addgene).

Techniques: Western Blot, Control, Over Expression, Binding Assay, Biomarker Discovery, Cell Counting, Plasmid Preparation, Transduction, Two Tailed Test

A Schematic illustration of the in vivo primary BMT assay and in vitro CFA with HSPCs co-transduced with MA9 retroviruses and Igf2bp3 shRNA (or shNS) lentiviruses. B Kaplan–Meier curves showing the effect of Igf2bp3 KD on MA9 -induced leukemogenesis. C Wright-Giemsa staining of BM cells and PB blood smear, and hematoxylin and eosin (H&E) staining of livers and spleens of the representative primary BMT mice from ( B ) at the endpoint. Scale bars from left to right: 20 μm, 50 μm, 200 μm, 300 μm. D , E CFA using mouse HSPCs transduced with MA9 ( D ) or PML-RARa ( E ) plus shNS, Bp3-sh1, or Bp3-sh2 viruses. F HSPCs from FLT3-ITD/NPM1-mut mice were transduced with shNS, Bp3-sh1, or Bp3-sh2 viruses and seeded for CFA. Bar = 200 μm. G HSPCs from Mettl14 fl/fl -CRE ERT mice were transduced with MA9 retroviruses and seeded for CFA. Mettl14 KO was induced by addition of 4-Hydroxytamoxifen (4-OHT, 1 mM) during plating. H Schematic illustration of the in vivo primary BMT assay and in vitro CFA with HSPCs from Igf2bp3 WT and KO mice. I Colony numbers and representative photos of colonies in the CFA assays illustrated in ( H ). Bar = 200 μm. J Flow cytometric analysis of CD45.2 + donor cell percentages in PB of recipient mice 8 weeks after BMT. n = 7 mice. K Kaplan–Meier curves showing the effect of Igf2bp3 KO on MA9 -induced leukemogenesis. L , M Representative images of liver ( L ) and spleen ( M ) tissues from the primary BMT mice in ( K ) at the endpoint. N Wright-Giemsa staining of BM cells and PB blood smear, and H&E staining of livers and spleens of representative primary BMT recipient mice from ( K ) at the endpoint. Scale bars are same as in ( C ). O HSPCs from WT or Igf2bp3 KO mice were co-transduced with MA9 and ATF4 -, PHGDH -, or PSAT1 -overexpressing viruses and seeded for CFA. P Schematic illustration of the secondary BMT assay and CFA with MA9 -induced leukemic cells transduced with Igf2bp3 shRNA (or shNS) lentiviruses. Q CFA assays showing the effect of Igf2bp3 KD on BM cells from MA9 leukemia mice. Bar = 200 μm. R Kaplan–Meier curves showing the result of secondary BMT using cells collected from the first plating of ( O ). Representative results from one of at least two mice were shown ( C , N ). Mean ± SD values are shown. n = 2 biologically independent repeats in ( D , E , F , G , I , O , and Q ). Statistical analysis: Two-tailed student’s t -test ( J ); log-rank test ( B , K , and R ). Source data are provided as a Source Data file.

Journal: Nature Communications

Article Title: m 6 A/IGF2BP3-driven serine biosynthesis fuels AML stemness and metabolic vulnerability

doi: 10.1038/s41467-025-58966-1

Figure Lengend Snippet: A Schematic illustration of the in vivo primary BMT assay and in vitro CFA with HSPCs co-transduced with MA9 retroviruses and Igf2bp3 shRNA (or shNS) lentiviruses. B Kaplan–Meier curves showing the effect of Igf2bp3 KD on MA9 -induced leukemogenesis. C Wright-Giemsa staining of BM cells and PB blood smear, and hematoxylin and eosin (H&E) staining of livers and spleens of the representative primary BMT mice from ( B ) at the endpoint. Scale bars from left to right: 20 μm, 50 μm, 200 μm, 300 μm. D , E CFA using mouse HSPCs transduced with MA9 ( D ) or PML-RARa ( E ) plus shNS, Bp3-sh1, or Bp3-sh2 viruses. F HSPCs from FLT3-ITD/NPM1-mut mice were transduced with shNS, Bp3-sh1, or Bp3-sh2 viruses and seeded for CFA. Bar = 200 μm. G HSPCs from Mettl14 fl/fl -CRE ERT mice were transduced with MA9 retroviruses and seeded for CFA. Mettl14 KO was induced by addition of 4-Hydroxytamoxifen (4-OHT, 1 mM) during plating. H Schematic illustration of the in vivo primary BMT assay and in vitro CFA with HSPCs from Igf2bp3 WT and KO mice. I Colony numbers and representative photos of colonies in the CFA assays illustrated in ( H ). Bar = 200 μm. J Flow cytometric analysis of CD45.2 + donor cell percentages in PB of recipient mice 8 weeks after BMT. n = 7 mice. K Kaplan–Meier curves showing the effect of Igf2bp3 KO on MA9 -induced leukemogenesis. L , M Representative images of liver ( L ) and spleen ( M ) tissues from the primary BMT mice in ( K ) at the endpoint. N Wright-Giemsa staining of BM cells and PB blood smear, and H&E staining of livers and spleens of representative primary BMT recipient mice from ( K ) at the endpoint. Scale bars are same as in ( C ). O HSPCs from WT or Igf2bp3 KO mice were co-transduced with MA9 and ATF4 -, PHGDH -, or PSAT1 -overexpressing viruses and seeded for CFA. P Schematic illustration of the secondary BMT assay and CFA with MA9 -induced leukemic cells transduced with Igf2bp3 shRNA (or shNS) lentiviruses. Q CFA assays showing the effect of Igf2bp3 KD on BM cells from MA9 leukemia mice. Bar = 200 μm. R Kaplan–Meier curves showing the result of secondary BMT using cells collected from the first plating of ( O ). Representative results from one of at least two mice were shown ( C , N ). Mean ± SD values are shown. n = 2 biologically independent repeats in ( D , E , F , G , I , O , and Q ). Statistical analysis: Two-tailed student’s t -test ( J ); log-rank test ( B , K , and R ). Source data are provided as a Source Data file.

Article Snippet: Human ATF4 , PHGDH and PSAT1 coding sequences were reverse-transcribed and PCR amplified from total RNA of Molm13, and subcloned into the cl20c-N-2×FLAG-GFP lentiviral vector. shRNA vectors targeting human or mouse IGF2BP3 , ATF4 , PHGDH , and PSAT1 were constructed by synthesizing shRNA-encoded DNA oligos and cloning them into the pLKO.1 vector (Addgene).

Techniques: In Vivo, In Vitro, Transduction, shRNA, Staining, Two Tailed Test

A Expression of IGF2BP3 mRNA in AML patient samples and healthy donors from the TNMplot database. Box plot, center line, median; box limits, upper and lower quartiles; whiskers, 1.5× interquartile range. n = 407 healthy samples; n = 151 AML samples. B Expression of IGF2BP3 in CD34 + and CD34 - cells from BM of healthy donors (normal) or AML patients as detected by microarray ( GSE30029 ). n = 31 CD34 + normal samples; n = 46 CD34 + AML samples; n = 44 CD34 - AML samples. C Expression of IGF2BP3 in blast (LSC − , non-engrafting) or LSC (LSC + , engrafting) cells from AML patients ( GSE199452 ). n = 40 LSC − samples; n = 70 LSC + samples. D Experimental scheme for ( E – G ). Patient-derived CD34 + cells were transduced with shNS or shRNAs targeting IGF2BP3 and subjected to different assays. E – G Growth curves ( E ), percentages of Annexin V + apoptotic cells ( F ), and colony numbers ( G ) of patient-derived CD34 + leukemia cells with or without IGF2BP3 KD. Bar = 200 μm. H The percentage of L-GMP population (CD45.2 + Lin - c-kit + Sca1 - CD34 + CD16/32 + ) in BM of the primary BMT mice. n = 6 mice per group. I , J Statistics of the percentage of Annexin V + ( I ) or Ki67 + ( J ) L-GMPs of mice in ( H ). n = 6 mice. K In vitro LDA assays using MA9 -transduced HSPCs from Igf2bp3 WT and KO mice. Logarithmic plots show the percentage of nonresponding wells (those without any colonies) at different doses of cells seeded. The estimated LSC/LIC frequency is calculated by ELDA and shown. L , M In vitro LDA assays of mouse HSPCs co-transduced with MA9 plus shRNA targeting Igf2bp3 ( L ) or its target genes ( M ). N HSPCs collected from Igf2bp3 WT and HO mice were co-transduced with MA9 and target gene-overexpressing viruses and selected in methylcellulose medium with G418 and puromycin for 7 days before seeded for LDA assays. Mean ± SD values are shown. n = 2 biologically independent repeats in E , G while n = 3 biologically independent repeats in ( F ). Statistical analysis: Two-tailed student’s t -test ( A , C , F , H – J ); two-way ANOVA ( B ); One-sided Chi-squared test ( K – N ). Source data are provided as a Source Data file.

Journal: Nature Communications

Article Title: m 6 A/IGF2BP3-driven serine biosynthesis fuels AML stemness and metabolic vulnerability

doi: 10.1038/s41467-025-58966-1

Figure Lengend Snippet: A Expression of IGF2BP3 mRNA in AML patient samples and healthy donors from the TNMplot database. Box plot, center line, median; box limits, upper and lower quartiles; whiskers, 1.5× interquartile range. n = 407 healthy samples; n = 151 AML samples. B Expression of IGF2BP3 in CD34 + and CD34 - cells from BM of healthy donors (normal) or AML patients as detected by microarray ( GSE30029 ). n = 31 CD34 + normal samples; n = 46 CD34 + AML samples; n = 44 CD34 - AML samples. C Expression of IGF2BP3 in blast (LSC − , non-engrafting) or LSC (LSC + , engrafting) cells from AML patients ( GSE199452 ). n = 40 LSC − samples; n = 70 LSC + samples. D Experimental scheme for ( E – G ). Patient-derived CD34 + cells were transduced with shNS or shRNAs targeting IGF2BP3 and subjected to different assays. E – G Growth curves ( E ), percentages of Annexin V + apoptotic cells ( F ), and colony numbers ( G ) of patient-derived CD34 + leukemia cells with or without IGF2BP3 KD. Bar = 200 μm. H The percentage of L-GMP population (CD45.2 + Lin - c-kit + Sca1 - CD34 + CD16/32 + ) in BM of the primary BMT mice. n = 6 mice per group. I , J Statistics of the percentage of Annexin V + ( I ) or Ki67 + ( J ) L-GMPs of mice in ( H ). n = 6 mice. K In vitro LDA assays using MA9 -transduced HSPCs from Igf2bp3 WT and KO mice. Logarithmic plots show the percentage of nonresponding wells (those without any colonies) at different doses of cells seeded. The estimated LSC/LIC frequency is calculated by ELDA and shown. L , M In vitro LDA assays of mouse HSPCs co-transduced with MA9 plus shRNA targeting Igf2bp3 ( L ) or its target genes ( M ). N HSPCs collected from Igf2bp3 WT and HO mice were co-transduced with MA9 and target gene-overexpressing viruses and selected in methylcellulose medium with G418 and puromycin for 7 days before seeded for LDA assays. Mean ± SD values are shown. n = 2 biologically independent repeats in E , G while n = 3 biologically independent repeats in ( F ). Statistical analysis: Two-tailed student’s t -test ( A , C , F , H – J ); two-way ANOVA ( B ); One-sided Chi-squared test ( K – N ). Source data are provided as a Source Data file.

Article Snippet: Human ATF4 , PHGDH and PSAT1 coding sequences were reverse-transcribed and PCR amplified from total RNA of Molm13, and subcloned into the cl20c-N-2×FLAG-GFP lentiviral vector. shRNA vectors targeting human or mouse IGF2BP3 , ATF4 , PHGDH , and PSAT1 were constructed by synthesizing shRNA-encoded DNA oligos and cloning them into the pLKO.1 vector (Addgene).

Techniques: Expressing, Microarray, Derivative Assay, Transduction, In Vitro, shRNA, Two Tailed Test

A Schematic outline of experimental strategy testing the effect of Igf2bp3 KO on mouse static normal hematopoiesis. n = 7 mice per group. B – D PB analysis of Igf2bp3 WT and KO mice. The density of white blood cells (WBC), lymphoma cells (LYM), red blood cells (RBC) ( C ), palates (PLT) ( D ), neutrophils (NEUT), monocytes (MONO), and eosinophils (EO) ( E ) are shown. E Flow cytometric gating strategies for HSC and progenitors. F , G Frequencies of various hematopoietic progenitors in the BM of Igf2bp3 WT and KO mice as examined by flow cytometry. LSK, Lin - Sca1 + cKit + cells; MPP, multipotent progenitor (Lin - Sca1 + cKit + CD48 + CD150 - ); LT-HSC, long-term HSC (Lin - Sca1 + cKit + CD48 - CD150 + ); ST-HSC, short-term HSC (Lin - Sca1 + cKit + CD48 - CD150 - ); LMPP, lymphoid-primed multipotent progenitor (Lin - Sca1 high cKit high CD127 + CD135 + ); CLP, common lymphoid progenitor (Lin - Sca1 low cKit low CD127 + CD135 + ); CMP, common myeloid progenitor (Lin - Sca1 - cKit + CD34 int CD16/32 low ); GMP, granulocyte-monocyte progenitor (Lin - Sca1 - cKit + CD34 + CD16/32 high ); MEP, megakaryocyte–erythroid progenitor (Lin - Sca1 - cKit + CD34 - CD16/32 - ). H Flow cytometric gating strategies for mature cells. I Frequencies of various mature cells in the BM of Igf2bp3 WT and KO mice as examined by flow cytometry. J Schematic outline of competitive repopulation assay. n = 7 mice per group. K Flow cytometric gating strategy for BM cells derived from Igf2bp3 WT or KO donor mice in the competitive repopulation assay. L Flow cytometry analysis for different donor-derived cells (CD45 + ) in PB of recipient mice 4, 8, 12, and 16 weeks after BMT. M , N Percentage of donor-derived stem cell ( M ) and progenitor ( N ) compartments in the bone marrow of recipients 16 weeks after BMT. Mean ± SD values are shown. Statistical analysis: Two-tailed student’s t -test ( B – D , F , G , I , L – N ); n.s., not significant. Source data are provided as a Source Data file.

Journal: Nature Communications

Article Title: m 6 A/IGF2BP3-driven serine biosynthesis fuels AML stemness and metabolic vulnerability

doi: 10.1038/s41467-025-58966-1

Figure Lengend Snippet: A Schematic outline of experimental strategy testing the effect of Igf2bp3 KO on mouse static normal hematopoiesis. n = 7 mice per group. B – D PB analysis of Igf2bp3 WT and KO mice. The density of white blood cells (WBC), lymphoma cells (LYM), red blood cells (RBC) ( C ), palates (PLT) ( D ), neutrophils (NEUT), monocytes (MONO), and eosinophils (EO) ( E ) are shown. E Flow cytometric gating strategies for HSC and progenitors. F , G Frequencies of various hematopoietic progenitors in the BM of Igf2bp3 WT and KO mice as examined by flow cytometry. LSK, Lin - Sca1 + cKit + cells; MPP, multipotent progenitor (Lin - Sca1 + cKit + CD48 + CD150 - ); LT-HSC, long-term HSC (Lin - Sca1 + cKit + CD48 - CD150 + ); ST-HSC, short-term HSC (Lin - Sca1 + cKit + CD48 - CD150 - ); LMPP, lymphoid-primed multipotent progenitor (Lin - Sca1 high cKit high CD127 + CD135 + ); CLP, common lymphoid progenitor (Lin - Sca1 low cKit low CD127 + CD135 + ); CMP, common myeloid progenitor (Lin - Sca1 - cKit + CD34 int CD16/32 low ); GMP, granulocyte-monocyte progenitor (Lin - Sca1 - cKit + CD34 + CD16/32 high ); MEP, megakaryocyte–erythroid progenitor (Lin - Sca1 - cKit + CD34 - CD16/32 - ). H Flow cytometric gating strategies for mature cells. I Frequencies of various mature cells in the BM of Igf2bp3 WT and KO mice as examined by flow cytometry. J Schematic outline of competitive repopulation assay. n = 7 mice per group. K Flow cytometric gating strategy for BM cells derived from Igf2bp3 WT or KO donor mice in the competitive repopulation assay. L Flow cytometry analysis for different donor-derived cells (CD45 + ) in PB of recipient mice 4, 8, 12, and 16 weeks after BMT. M , N Percentage of donor-derived stem cell ( M ) and progenitor ( N ) compartments in the bone marrow of recipients 16 weeks after BMT. Mean ± SD values are shown. Statistical analysis: Two-tailed student’s t -test ( B – D , F , G , I , L – N ); n.s., not significant. Source data are provided as a Source Data file.

Article Snippet: Human ATF4 , PHGDH and PSAT1 coding sequences were reverse-transcribed and PCR amplified from total RNA of Molm13, and subcloned into the cl20c-N-2×FLAG-GFP lentiviral vector. shRNA vectors targeting human or mouse IGF2BP3 , ATF4 , PHGDH , and PSAT1 were constructed by synthesizing shRNA-encoded DNA oligos and cloning them into the pLKO.1 vector (Addgene).

Techniques: Flow Cytometry, Derivative Assay, Two Tailed Test

A Experimental scheme for ( B ) and ( C ). M-NSG immunodeficient recipient mice were transplanted with AML PDX cells (FLT3-TKD mutation) transduced with shNS or shRNA targeting Igf2bp3, and fed with a regular (control) or SG-free (-SG) diet. B Colony numbers of AML PDX cells (FLT3-TKD) are shown to reflect the effect of SG deprivation (-SG) on control (NS) or Igf2bp3 KD (shBp3) cells compared to complete medium (CM). C Kaplan–Meier curves showing survival of recipient mice fed with a regular (control) diet or an equivalent diet lacking SG (-SG). n = 7 mice per group. D Experimental scheme for ( E ) and ( F ). BM cells from MA9 leukemic mice were transduced with shNS or shRNA targeting Igf2bp3 and selected with puromycin before subjected to CFA assays ( E ) or BMT assays ( F ). E Colony numbers in CFA assays are shown to reflect the effect of SG deprivation (-SG) on control (NS) or Igf2bp3 KD (shBp3) cells compared to complete medium (CM). F Kaplan–Meier curves showing survival of recipient mice fed with a regular (control) diet or an equivalent diet lacking SG (-SG). n = 8 mice per group. G Experimental scheme of the xenotransplantation assays in ( H ). M-NSG immunodeficient recipient mice were transplanted with U937 BP3-mAID cells and fed with a regular (control) or SG-free (-SG) diet. 5’Ph-IAA (3 mg/kg) or vehicle control (DMSO) were given via intraperitoneal injection (i.p.) every day for 7 consecutive days starting from the 8th day after transplantation. H Kaplan–Meier curves showing survival of the M-NSG recipient mice in ( G ). n = 7 mice per group. I Schematic illustration of the working model and therapeutic strategy proposed in the study, created with the assistance of GDP (Agreement number: GDP2025KABQ7W). Mean ± SD values are shown. n = 2 biologically independent repeats in ( B ) and ( E ). Statistical analysis: log-rank test ( C , F , and H ). Source data are provided as a Source Data file.

Journal: Nature Communications

Article Title: m 6 A/IGF2BP3-driven serine biosynthesis fuels AML stemness and metabolic vulnerability

doi: 10.1038/s41467-025-58966-1

Figure Lengend Snippet: A Experimental scheme for ( B ) and ( C ). M-NSG immunodeficient recipient mice were transplanted with AML PDX cells (FLT3-TKD mutation) transduced with shNS or shRNA targeting Igf2bp3, and fed with a regular (control) or SG-free (-SG) diet. B Colony numbers of AML PDX cells (FLT3-TKD) are shown to reflect the effect of SG deprivation (-SG) on control (NS) or Igf2bp3 KD (shBp3) cells compared to complete medium (CM). C Kaplan–Meier curves showing survival of recipient mice fed with a regular (control) diet or an equivalent diet lacking SG (-SG). n = 7 mice per group. D Experimental scheme for ( E ) and ( F ). BM cells from MA9 leukemic mice were transduced with shNS or shRNA targeting Igf2bp3 and selected with puromycin before subjected to CFA assays ( E ) or BMT assays ( F ). E Colony numbers in CFA assays are shown to reflect the effect of SG deprivation (-SG) on control (NS) or Igf2bp3 KD (shBp3) cells compared to complete medium (CM). F Kaplan–Meier curves showing survival of recipient mice fed with a regular (control) diet or an equivalent diet lacking SG (-SG). n = 8 mice per group. G Experimental scheme of the xenotransplantation assays in ( H ). M-NSG immunodeficient recipient mice were transplanted with U937 BP3-mAID cells and fed with a regular (control) or SG-free (-SG) diet. 5’Ph-IAA (3 mg/kg) or vehicle control (DMSO) were given via intraperitoneal injection (i.p.) every day for 7 consecutive days starting from the 8th day after transplantation. H Kaplan–Meier curves showing survival of the M-NSG recipient mice in ( G ). n = 7 mice per group. I Schematic illustration of the working model and therapeutic strategy proposed in the study, created with the assistance of GDP (Agreement number: GDP2025KABQ7W). Mean ± SD values are shown. n = 2 biologically independent repeats in ( B ) and ( E ). Statistical analysis: log-rank test ( C , F , and H ). Source data are provided as a Source Data file.

Article Snippet: Human ATF4 , PHGDH and PSAT1 coding sequences were reverse-transcribed and PCR amplified from total RNA of Molm13, and subcloned into the cl20c-N-2×FLAG-GFP lentiviral vector. shRNA vectors targeting human or mouse IGF2BP3 , ATF4 , PHGDH , and PSAT1 were constructed by synthesizing shRNA-encoded DNA oligos and cloning them into the pLKO.1 vector (Addgene).

Techniques: Mutagenesis, Transduction, shRNA, Control, Injection, Transplantation Assay

Effects of 15-LOX-1 downregulation on terminal cell differentiation, tight junction formation, and E-cadherin membrane localization in colon cells. Caco-2 wild-type (WT) cells and clones of 15-LOX-1 shRNA stably transfected Caco-2 cells with either successful [15-LOX-1 KD (+)] or unsuccessful [15-LOX-1 KD (−)] 15-LOX-1 knockdown were treated with sodium butyrate (NaBT) for 48 hours and then harvested and processed for 15-LOX-1 expression by Western blotting (Fig. 5A) and alkaline phosphatase enzymatic activity as a marker of cell differentiation (Fig. 5B). Values are the means and standard errors of the means of triplicate measurements. * P < 0.0001 (two-way analysis of variance). Positive control in A is cell lysate protein extract from HCT-116 cells transfected with a 15-LOX-1 expression vector. C, 15-LOX-1 KD (+) and 15-LOX-1 KD (−) cells were cultured for 14 days after confluence. 15-LOX-1 mRNA levels were measured by quantitative real-time reverse transcription-polymerase chain reaction on days 0 and 14 after confluence. Values are the means and standard errors of the means of triplicate measurements. * P < 0.0001 (two-way analysis of variance). D, 15-LOX-1 KD (+) and 15-LOX-1 KD (−) cells were evaluated for tight junction formation using FITC-dextran fluorescence permeability assay on day 14 after confluence. Relative fluorescence intensity values (relative to that of wild-type Caco-2 cells) at various time points are shown. Values are the means and standard errors of the means of triplicate measurements of three experiments. * P < 0.008 (t-test). E, 15-LOX-1 KD (+) and 15-LOX-1 KD (−) cells were cultured for the indicated numbers of days after confluence. Equal protein amounts from cytoskeleton-associated (insoluble) and total cell lysates were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis separation followed by Western blotting. Band intensities (lower panel) for the blotted E-cadherin were quantified using an Odyssey fluorescent imager (LI-COR Biosciences, Lincoln, NE) and Odyssey software.

Journal: Cancer prevention research (Philadelphia, Pa.)

Article Title: Mechanistic Contribution of Ubiquitous 15-Lipoxygenase-1 Expression Loss in Cancer Cells to Terminal Cell Differentiation Evasion

doi: 10.1158/1940-6207.CAPR-10-0280

Figure Lengend Snippet: Effects of 15-LOX-1 downregulation on terminal cell differentiation, tight junction formation, and E-cadherin membrane localization in colon cells. Caco-2 wild-type (WT) cells and clones of 15-LOX-1 shRNA stably transfected Caco-2 cells with either successful [15-LOX-1 KD (+)] or unsuccessful [15-LOX-1 KD (−)] 15-LOX-1 knockdown were treated with sodium butyrate (NaBT) for 48 hours and then harvested and processed for 15-LOX-1 expression by Western blotting (Fig. 5A) and alkaline phosphatase enzymatic activity as a marker of cell differentiation (Fig. 5B). Values are the means and standard errors of the means of triplicate measurements. * P < 0.0001 (two-way analysis of variance). Positive control in A is cell lysate protein extract from HCT-116 cells transfected with a 15-LOX-1 expression vector. C, 15-LOX-1 KD (+) and 15-LOX-1 KD (−) cells were cultured for 14 days after confluence. 15-LOX-1 mRNA levels were measured by quantitative real-time reverse transcription-polymerase chain reaction on days 0 and 14 after confluence. Values are the means and standard errors of the means of triplicate measurements. * P < 0.0001 (two-way analysis of variance). D, 15-LOX-1 KD (+) and 15-LOX-1 KD (−) cells were evaluated for tight junction formation using FITC-dextran fluorescence permeability assay on day 14 after confluence. Relative fluorescence intensity values (relative to that of wild-type Caco-2 cells) at various time points are shown. Values are the means and standard errors of the means of triplicate measurements of three experiments. * P < 0.008 (t-test). E, 15-LOX-1 KD (+) and 15-LOX-1 KD (−) cells were cultured for the indicated numbers of days after confluence. Equal protein amounts from cytoskeleton-associated (insoluble) and total cell lysates were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis separation followed by Western blotting. Band intensities (lower panel) for the blotted E-cadherin were quantified using an Odyssey fluorescent imager (LI-COR Biosciences, Lincoln, NE) and Odyssey software.

Article Snippet: We selected the pRS-15-LOX-1-shRNA-83 vector (OriGene) containing 29-base-pair shRNA forward sequence of 15-LOX-1: AGGCTTCTCTCCAGATGTCCATCACTTGG for the stable transfection experiments on the basis of preliminary studies showing efficient 15-LOX-1 gene downregulation.

Techniques: Cell Differentiation, Clone Assay, shRNA, Stable Transfection, Transfection, Expressing, Western Blot, Activity Assay, Marker, Positive Control, Plasmid Preparation, Cell Culture, Reverse Transcription Polymerase Chain Reaction, Fluorescence, Permeability, Polyacrylamide Gel Electrophoresis, Software

15-LOX-1 and differentiation of primary NHBE cells. Primary NHBE cells were grown for 3 weeks in an undifferentiated state in immersion cultures or in air-liquid interface cultures to induce terminal differentiation into bronchial epithelial-like structures. Cells were then harvested and processed for quantitative real-time reverse transcription-polymerase chain reaction (panel A, differentiated vs. undifferentiated NHBE cells, P = 0.0005), Western blotting (panel B), and 13-HODE levels by liquid chromatography tandem mass spectroscopy (panel C, differentiated vs. undifferentiated NHBE cells, P = 0.0002). + represents 15-LOX-1 positive control (HCT-116 colon cancer cells transfected with 15-LOX-1 expression vector).

Journal: Cancer prevention research (Philadelphia, Pa.)

Article Title: Mechanistic Contribution of Ubiquitous 15-Lipoxygenase-1 Expression Loss in Cancer Cells to Terminal Cell Differentiation Evasion

doi: 10.1158/1940-6207.CAPR-10-0280

Figure Lengend Snippet: 15-LOX-1 and differentiation of primary NHBE cells. Primary NHBE cells were grown for 3 weeks in an undifferentiated state in immersion cultures or in air-liquid interface cultures to induce terminal differentiation into bronchial epithelial-like structures. Cells were then harvested and processed for quantitative real-time reverse transcription-polymerase chain reaction (panel A, differentiated vs. undifferentiated NHBE cells, P = 0.0005), Western blotting (panel B), and 13-HODE levels by liquid chromatography tandem mass spectroscopy (panel C, differentiated vs. undifferentiated NHBE cells, P = 0.0002). + represents 15-LOX-1 positive control (HCT-116 colon cancer cells transfected with 15-LOX-1 expression vector).

Article Snippet: We selected the pRS-15-LOX-1-shRNA-83 vector (OriGene) containing 29-base-pair shRNA forward sequence of 15-LOX-1: AGGCTTCTCTCCAGATGTCCATCACTTGG for the stable transfection experiments on the basis of preliminary studies showing efficient 15-LOX-1 gene downregulation.

Techniques: Reverse Transcription Polymerase Chain Reaction, Western Blot, Liquid Chromatography, Tandem Mass Spectroscopy, Positive Control, Transfection, Expressing, Plasmid Preparation

15-LOX-1 and P16 mRNA and protein expression levels in cancer cell lines. A and B, A total of 128 cancer cell lines (Supplementary Table S1) were cultured and processed for 15-LOX-1 (panel A) and p16 (panel B) mRNA by quantitative real-time reverse transcription-polymerase chain reaction. Dots in the dot plots are means of triplicate measurements from each cell line. The relative expression levels were calculated relative to expression of the calibrator sample (differentiated NHBE cells). Solid lines represent the median value for each group. C, 15-LOX-1 relative expression levels in cancer cell lines compared to the level in Caco-2 cells terminally differentiated by sodium butyrate treatment. 15-LOX-1 mRNA measurements are as in panel A but with terminally differentiated Caco-2 cells as the calibrator sample. Dots in the dot plots are means of triplicate measurements from each cell line. The solid line represents the median value for the relative expression levels. D, 15-LOX-1 protein expression in cancer cell lines. Cell lines—including cell lines with 15-LOX-1 mRNA expression levels nearly equal to or greater than the level in differentiated Caco-2 cells or NHEK—were cultured, processed for Western blotting, and probed with 15-LOX-1 antibody. Three repeated experiments yielded similar results.

Journal: Cancer prevention research (Philadelphia, Pa.)

Article Title: Mechanistic Contribution of Ubiquitous 15-Lipoxygenase-1 Expression Loss in Cancer Cells to Terminal Cell Differentiation Evasion

doi: 10.1158/1940-6207.CAPR-10-0280

Figure Lengend Snippet: 15-LOX-1 and P16 mRNA and protein expression levels in cancer cell lines. A and B, A total of 128 cancer cell lines (Supplementary Table S1) were cultured and processed for 15-LOX-1 (panel A) and p16 (panel B) mRNA by quantitative real-time reverse transcription-polymerase chain reaction. Dots in the dot plots are means of triplicate measurements from each cell line. The relative expression levels were calculated relative to expression of the calibrator sample (differentiated NHBE cells). Solid lines represent the median value for each group. C, 15-LOX-1 relative expression levels in cancer cell lines compared to the level in Caco-2 cells terminally differentiated by sodium butyrate treatment. 15-LOX-1 mRNA measurements are as in panel A but with terminally differentiated Caco-2 cells as the calibrator sample. Dots in the dot plots are means of triplicate measurements from each cell line. The solid line represents the median value for the relative expression levels. D, 15-LOX-1 protein expression in cancer cell lines. Cell lines—including cell lines with 15-LOX-1 mRNA expression levels nearly equal to or greater than the level in differentiated Caco-2 cells or NHEK—were cultured, processed for Western blotting, and probed with 15-LOX-1 antibody. Three repeated experiments yielded similar results.

Article Snippet: We selected the pRS-15-LOX-1-shRNA-83 vector (OriGene) containing 29-base-pair shRNA forward sequence of 15-LOX-1: AGGCTTCTCTCCAGATGTCCATCACTTGG for the stable transfection experiments on the basis of preliminary studies showing efficient 15-LOX-1 gene downregulation.

Techniques: Expressing, Cell Culture, Reverse Transcription Polymerase Chain Reaction, Western Blot

15-LOX-1 expression in normal and cancerous lung cells. A, Non-tumorigenic immortalized normal human bronchial epithelial cells (HBEC) (HBEC3KT, HBEC6KT, HBEC12KT, and HBEC24KT) and H460 lung cancer cells were grown in air-liquid interface cultures that were paraffin embedded, sectioned, and examined with hematoxylin-eosin (H&E) staining and 15-LOX-1 immunohistochemistry staining (IHC). B, Paired normal and non-small cell lung cancer tissues were immunohistochemically stained for expression of 15-LOX-1. Values are the intensity scores for 15-LOX-1 immunohistochemistry cytoplasmic staining (IHC intensity scores) in each individual case as listed in the table. NA: tissue samples were not available.

Journal: Cancer prevention research (Philadelphia, Pa.)

Article Title: Mechanistic Contribution of Ubiquitous 15-Lipoxygenase-1 Expression Loss in Cancer Cells to Terminal Cell Differentiation Evasion

doi: 10.1158/1940-6207.CAPR-10-0280

Figure Lengend Snippet: 15-LOX-1 expression in normal and cancerous lung cells. A, Non-tumorigenic immortalized normal human bronchial epithelial cells (HBEC) (HBEC3KT, HBEC6KT, HBEC12KT, and HBEC24KT) and H460 lung cancer cells were grown in air-liquid interface cultures that were paraffin embedded, sectioned, and examined with hematoxylin-eosin (H&E) staining and 15-LOX-1 immunohistochemistry staining (IHC). B, Paired normal and non-small cell lung cancer tissues were immunohistochemically stained for expression of 15-LOX-1. Values are the intensity scores for 15-LOX-1 immunohistochemistry cytoplasmic staining (IHC intensity scores) in each individual case as listed in the table. NA: tissue samples were not available.

Article Snippet: We selected the pRS-15-LOX-1-shRNA-83 vector (OriGene) containing 29-base-pair shRNA forward sequence of 15-LOX-1: AGGCTTCTCTCCAGATGTCCATCACTTGG for the stable transfection experiments on the basis of preliminary studies showing efficient 15-LOX-1 gene downregulation.

Techniques: Expressing, Staining, Immunohistochemistry

Effects of 15-LOX-1 expression on Caco-2 cell spontaneous enterocyte differentiation. A and B, Effects of 15-LOX-1 shRNA on induced 15-LOX-1 expression during Caco-2 cell spontaneous enterocyte differentiation. Caco-2 cells were stably transfected with either non-targeted shRNA (control shRNA) or 15-LOX-1 shRNA and cultured for 14 days after confluence. Cells were collected at the time of confluence (0) and 14 days after confluence. 15-LOX-1 mRNA levels were measured by quantitative real-time reverse transcription-polymerase chain reaction (A) and Western blotting (B). The relative expression levels in A were calculated relative to the expression level of the calibrator sample (control shRNA, day 0). Values shown are the means ± standard deviations of triplicate measurements. * P < 0.0001. Positive control in B is cell lysate protein extract from HCT-116 cells transfected with a 15-LOX-1 expression vector. C, Effects of 15-LOX-1 on the morphology of Caco-2 cells. Caco-2 cells were cultured as described for panel A for 14 days after confluence and then fixed and examined by transmission electron microscopy. Magnifications are as indicated for each of the images. D and E, Effects of 15-LOX-1 downregulation on cell-cell contact and tight junction assembly. Caco-2 cells transfected with 15-LOX-1 shRNA or control vector were cultured to induce terminal differentiation for 14 days after confluence. Cells were processed for immunofluorescence using either ZO-1 or E-cadherin antibodies. Representative confocal microscope-captured images for staining with ZO-1 (D) and E-cadherin (E) are shown. The images for ZO-1 in the right column represent enlarged sections of the images in the left column. These enlargements demonstrate the differences in the plasma membrane structure of the cells. Bar, 10 µm.

Journal: Cancer prevention research (Philadelphia, Pa.)

Article Title: Mechanistic Contribution of Ubiquitous 15-Lipoxygenase-1 Expression Loss in Cancer Cells to Terminal Cell Differentiation Evasion

doi: 10.1158/1940-6207.CAPR-10-0280

Figure Lengend Snippet: Effects of 15-LOX-1 expression on Caco-2 cell spontaneous enterocyte differentiation. A and B, Effects of 15-LOX-1 shRNA on induced 15-LOX-1 expression during Caco-2 cell spontaneous enterocyte differentiation. Caco-2 cells were stably transfected with either non-targeted shRNA (control shRNA) or 15-LOX-1 shRNA and cultured for 14 days after confluence. Cells were collected at the time of confluence (0) and 14 days after confluence. 15-LOX-1 mRNA levels were measured by quantitative real-time reverse transcription-polymerase chain reaction (A) and Western blotting (B). The relative expression levels in A were calculated relative to the expression level of the calibrator sample (control shRNA, day 0). Values shown are the means ± standard deviations of triplicate measurements. * P < 0.0001. Positive control in B is cell lysate protein extract from HCT-116 cells transfected with a 15-LOX-1 expression vector. C, Effects of 15-LOX-1 on the morphology of Caco-2 cells. Caco-2 cells were cultured as described for panel A for 14 days after confluence and then fixed and examined by transmission electron microscopy. Magnifications are as indicated for each of the images. D and E, Effects of 15-LOX-1 downregulation on cell-cell contact and tight junction assembly. Caco-2 cells transfected with 15-LOX-1 shRNA or control vector were cultured to induce terminal differentiation for 14 days after confluence. Cells were processed for immunofluorescence using either ZO-1 or E-cadherin antibodies. Representative confocal microscope-captured images for staining with ZO-1 (D) and E-cadherin (E) are shown. The images for ZO-1 in the right column represent enlarged sections of the images in the left column. These enlargements demonstrate the differences in the plasma membrane structure of the cells. Bar, 10 µm.

Article Snippet: We selected the pRS-15-LOX-1-shRNA-83 vector (OriGene) containing 29-base-pair shRNA forward sequence of 15-LOX-1: AGGCTTCTCTCCAGATGTCCATCACTTGG for the stable transfection experiments on the basis of preliminary studies showing efficient 15-LOX-1 gene downregulation.

Techniques: Expressing, shRNA, Stable Transfection, Transfection, Cell Culture, Reverse Transcription Polymerase Chain Reaction, Western Blot, Positive Control, Plasmid Preparation, Transmission Assay, Electron Microscopy, Immunofluorescence, Microscopy, Staining

(A) A protein interaction network of SPG11 illustrating novel protein interactors identified by mass spectrometry in this study (orange edges), literature-derived protein interactors from PINOT and BioPlex 3.0 (blue edges), and an interactor common to both our novel dataset and literature-derived data (green edge). The edge thickness positively correlates with protein interaction confidence based on distinct method detection strategies used and the number of specific documented reports. (B) The subcellular localisation of the interactors resulted from our AP/MS analysis and of SPG11 is visualised, with each colour corresponding to a different location block. The collection of subcellular location data in the form of Gene Ontology cellular component terms was performed through AmiGO and the grouping of each term into location blocks with an in-house grouping protocol.

Journal: bioRxiv

Article Title: PKA-mediated phosphorylation of SPG11/spatacsin regulates binding with a subset of 14-3-3 proteins

doi: 10.1101/2020.09.09.289009

Figure Lengend Snippet: (A) A protein interaction network of SPG11 illustrating novel protein interactors identified by mass spectrometry in this study (orange edges), literature-derived protein interactors from PINOT and BioPlex 3.0 (blue edges), and an interactor common to both our novel dataset and literature-derived data (green edge). The edge thickness positively correlates with protein interaction confidence based on distinct method detection strategies used and the number of specific documented reports. (B) The subcellular localisation of the interactors resulted from our AP/MS analysis and of SPG11 is visualised, with each colour corresponding to a different location block. The collection of subcellular location data in the form of Gene Ontology cellular component terms was performed through AmiGO and the grouping of each term into location blocks with an in-house grouping protocol.

Article Snippet: The sequence of human SPG11 was cloned into a pReceiver-M12 Expression Clone vector (GeneCopoeia).

Techniques: Mass Spectrometry, Derivative Assay, Protein-Protein interactions, Blocking Assay

(A) 3xFlag-SPG11 overexpressed in HEK293T cells pulls down endogenous 14-3-3 proteins. (B) Immunocytochemical evaluation of 3xFlag-SPG11 subcellular compartmentalisation in HeLa cells reveals predominant perinuclear localisation, partially overlapping with the ER marker calnexin, and sporadic enrichment at the cell periphery in protrusions-like structures. (C) Co-staining of 3xFlag-SPG11 and 14-3-3s suggests that SPG11 only overlaps with a subset of 14-3-3s, as confirmed via pull-down assays between 3xFlag-SPG11 and recombinant 14-3-3 isoforms purified by IMAC (D). Scale bars=20μm.

Journal: bioRxiv

Article Title: PKA-mediated phosphorylation of SPG11/spatacsin regulates binding with a subset of 14-3-3 proteins

doi: 10.1101/2020.09.09.289009

Figure Lengend Snippet: (A) 3xFlag-SPG11 overexpressed in HEK293T cells pulls down endogenous 14-3-3 proteins. (B) Immunocytochemical evaluation of 3xFlag-SPG11 subcellular compartmentalisation in HeLa cells reveals predominant perinuclear localisation, partially overlapping with the ER marker calnexin, and sporadic enrichment at the cell periphery in protrusions-like structures. (C) Co-staining of 3xFlag-SPG11 and 14-3-3s suggests that SPG11 only overlaps with a subset of 14-3-3s, as confirmed via pull-down assays between 3xFlag-SPG11 and recombinant 14-3-3 isoforms purified by IMAC (D). Scale bars=20μm.

Article Snippet: The sequence of human SPG11 was cloned into a pReceiver-M12 Expression Clone vector (GeneCopoeia).

Techniques: Marker, Staining, Recombinant, Purification

(A) Schematic of the putative 14-3-3 binding sites predicted by 14-3-3-Pred. Ser1955, highlighted in light blue, was also reported to be a phosphorylated residue by PhosphoSitePlus ® , and confirmed by phospho-peptide enrichment experiments performed in this work. (B) Binding affinity of 14-3-3s for phosphorylated SPG11-Ser1955 was confirmed through generation of phospho-deficient S1955A-mutant by site-directed mutagenesis. The non-phosphorylatable mutant displays ~ 50% reduction in binding as compared to the WT counterpart.

Journal: bioRxiv

Article Title: PKA-mediated phosphorylation of SPG11/spatacsin regulates binding with a subset of 14-3-3 proteins

doi: 10.1101/2020.09.09.289009

Figure Lengend Snippet: (A) Schematic of the putative 14-3-3 binding sites predicted by 14-3-3-Pred. Ser1955, highlighted in light blue, was also reported to be a phosphorylated residue by PhosphoSitePlus ® , and confirmed by phospho-peptide enrichment experiments performed in this work. (B) Binding affinity of 14-3-3s for phosphorylated SPG11-Ser1955 was confirmed through generation of phospho-deficient S1955A-mutant by site-directed mutagenesis. The non-phosphorylatable mutant displays ~ 50% reduction in binding as compared to the WT counterpart.

Article Snippet: The sequence of human SPG11 was cloned into a pReceiver-M12 Expression Clone vector (GeneCopoeia).

Techniques: Binding Assay, Residue, Mutagenesis

(A) Summary of the putative kinases phosphorylating SPG11 on Ser1955, with relative confidence score, as obtained from NetPhos 3.1. The PKA consensus sequence is also indicated and aligned against the SPG11 motif containing Ser1955. (B) Endogenous SPG11 was pulled down from genome-edited monoclonal lines taking advantage of the 3xFlag tag sequence inserted at the endogenous locus. 15 minutes treatment with Forskolin/IBMX increases binding affinity for η-14-3-3, suggesting that phosphorylation by PKA on Ser1955 is the signal regulating interaction (n=2). (C) PLA experiments confirmed (i) interaction between SPG11 and 14-3-3s at the endogenous level and (ii) increased binding in the presence of PKA activation. (PLA reactions were performed between rabbit α-Flag and mouse α-pan-14-3-3 antibodies. Average background signal detected in naïve cells, employed as a negative control for the reaction, was subtracted to all measurements; n=2, ~125 cells counted/condition).

Journal: bioRxiv

Article Title: PKA-mediated phosphorylation of SPG11/spatacsin regulates binding with a subset of 14-3-3 proteins

doi: 10.1101/2020.09.09.289009

Figure Lengend Snippet: (A) Summary of the putative kinases phosphorylating SPG11 on Ser1955, with relative confidence score, as obtained from NetPhos 3.1. The PKA consensus sequence is also indicated and aligned against the SPG11 motif containing Ser1955. (B) Endogenous SPG11 was pulled down from genome-edited monoclonal lines taking advantage of the 3xFlag tag sequence inserted at the endogenous locus. 15 minutes treatment with Forskolin/IBMX increases binding affinity for η-14-3-3, suggesting that phosphorylation by PKA on Ser1955 is the signal regulating interaction (n=2). (C) PLA experiments confirmed (i) interaction between SPG11 and 14-3-3s at the endogenous level and (ii) increased binding in the presence of PKA activation. (PLA reactions were performed between rabbit α-Flag and mouse α-pan-14-3-3 antibodies. Average background signal detected in naïve cells, employed as a negative control for the reaction, was subtracted to all measurements; n=2, ~125 cells counted/condition).

Article Snippet: The sequence of human SPG11 was cloned into a pReceiver-M12 Expression Clone vector (GeneCopoeia).

Techniques: Sequencing, Binding Assay, Phospho-proteomics, Activation Assay, Negative Control

(A) Cell surface biotinylation assay showing endogenous SPG11 internalisation upon 15 minutes treatment with Forskolin, suggesting that PKA activation is the stimulus to initiate SPG11 trafficking towards intracellular compartments. (B) Representative images of HeLa cells transfected with WT or S1955A-SPG11 and treated with Forskolin/IBMX for 15 and 90 minutes show that only the WT protein is able to respond to PKA activation, suggesting that the mechanism is mediated by 14-3-3 binding. White arrowheads indicate SPG11 enrichment at protrusion-like structures, which is reduced after 15 minutes treatment with Forskolin/IBMX. Scale bar=20μm.

Journal: bioRxiv

Article Title: PKA-mediated phosphorylation of SPG11/spatacsin regulates binding with a subset of 14-3-3 proteins

doi: 10.1101/2020.09.09.289009

Figure Lengend Snippet: (A) Cell surface biotinylation assay showing endogenous SPG11 internalisation upon 15 minutes treatment with Forskolin, suggesting that PKA activation is the stimulus to initiate SPG11 trafficking towards intracellular compartments. (B) Representative images of HeLa cells transfected with WT or S1955A-SPG11 and treated with Forskolin/IBMX for 15 and 90 minutes show that only the WT protein is able to respond to PKA activation, suggesting that the mechanism is mediated by 14-3-3 binding. White arrowheads indicate SPG11 enrichment at protrusion-like structures, which is reduced after 15 minutes treatment with Forskolin/IBMX. Scale bar=20μm.

Article Snippet: The sequence of human SPG11 was cloned into a pReceiver-M12 Expression Clone vector (GeneCopoeia).

Techniques: Cell Surface Biotinylation Assay, Activation Assay, Transfection, Binding Assay

Canonical motifs for interactions with binding partners and transmembrane domains that have been predicted or identified by other groups ( ; ) and confirmed by in silico data from this study are summarised. The AP5-interacting region and the spatacsin C domain, which shares sequence and structure similarity with the Vps16 protein, identified in the study by Patto and O’Kane are also included, together with the phospho-peptide responsible for the binding of 14-3-3s identified in this study.

Journal: bioRxiv

Article Title: PKA-mediated phosphorylation of SPG11/spatacsin regulates binding with a subset of 14-3-3 proteins

doi: 10.1101/2020.09.09.289009

Figure Lengend Snippet: Canonical motifs for interactions with binding partners and transmembrane domains that have been predicted or identified by other groups ( ; ) and confirmed by in silico data from this study are summarised. The AP5-interacting region and the spatacsin C domain, which shares sequence and structure similarity with the Vps16 protein, identified in the study by Patto and O’Kane are also included, together with the phospho-peptide responsible for the binding of 14-3-3s identified in this study.

Article Snippet: The sequence of human SPG11 was cloned into a pReceiver-M12 Expression Clone vector (GeneCopoeia).

Techniques: Binding Assay, In Silico, Sequencing

3D rendering (A) and average values of 18F-Fluciclovine uptake (B) in ~10–12-week-old male CON and LrpprcBKO mice. White cycle: BAT. Sample size: CON (n=9) and LrpprcBKO (n=8). (C) Left: Immunoblots of p-S6, total S6, p-4Ebp1, total 4Ebp1, puromycylated protein, ubiquitinated protein and Hsp90 in the BAT of ~10-week-old male CON and ATF4BOX mice at ad libitum feeding at RT and 30°C. Right: Relative abundance (to Hsp90) or phosphorylation (to total protein) shown. Significance between genotypes indicated. (D) Core temperature drop of ~10-week-old male and female LrpprcBKO mice and their relative controls with pretreatment of DMSO, or 4mg kg−1 rapamycin (RAPA), or 0.625mg kg−1 bortezomib (BORT), or 50mg kg−1 BCH after 8 hours 4°C CTT from RT. Sample size: CON/RT/DMSO (n=9), LrpprcBKO/RT/DMSO (n=10), CON/RT/RAPA (n=6), LrpprcBKO/RT/RAPA (n=7), CON/RT/BORT (n=4), LrpprcBKO/RT/BORT (n=4), CON/RT/BCH (n=8) and LrpprcBKO/RT/BCH (n=5). (E) Core temperature drop of ~10-week-old male and female CON and ATF4BOX mice with pretreatment of DMSO or RAPA or BORT or BCH after 3 hours 4°C CTT from 30°C. Sample size: CON/30°C/DMSO (n=14), ATF4BOX/30°C/DMSO (n=14), CON/30°C/RAPA (n=5), ATF4BOX/30°C/RAPA (n=8), CON/30°C/BORT (n=5), ATF4BOX/30°C/BORT (n=7), CON/30°C/BCH (n=4) and ATF4BOX/30°C/BCH (n=9). (F) Core temperature drop of ~10-week-old male and female Ucp1 KO and ATF4BOX;Ucp1 KO mice with pretreatment of DMSO or RAPA or BORT or BCH after 3 hours 4°C CTT from RT. Sample size: Ucp1 KO/RT/DMSO (n=5), ATF4BOX;Ucp1 KO/RT/DMSO (n=3), Ucp1 KO/RT/RAPA (n=10), ATF4BOX;Ucp1 KO/RT/RAPA (n=5), Ucp1 KO/RT/BORT (n=4), ATF4BOX;Ucp1 KO/RT/BORT (n=4), Ucp1 KO/RT/BCH (n=5) and ATF4BOX;Ucp1 KO/RT/BCH (n=5). (G) The Temp (Neck-Back) of ~12-week-old male and female CON and LrpprcBKO mice 2 hours after injections of RAPA or BORT or DMSO at thermoneutrality. Sample size: CON (n=6) and LrpprcBKO (n=11). (H) The Temp (Neck-Back) of ~12-week-old male and female CON and ATF4BOX mice 2 hours after injections of RAPA or BORT or DMSO at thermoneutrality. Sample size: CON (n=7) and ATF4BOX (n=8). (I) The Temp (Neck-Back) of ~12-week-old male and female Ucp1 KO and ATF4BOX;Ucp1 KO mice 2 hours after injections of RAPA or BORT or DMSO at thermoneutrality. Sample size: Ucp1 KO (n=6) and ATF4BOX;Ucp1 KO (n=9). (J) Experimental setup of pSILAC in ATF4-expressing differentiated BAs. BAT SVF cells from ROSA-LSL-ATF4 or ROSA-LSL-ATF4;Ucp1 KO mice were cultured and differentiated in vitro. Four days after differentiation, GFP or Cre adenovirus were added at 100 MOI for two days. Cells were cultured in light medium from day 0 to 8, then transferred to heavy medium up to one day. Cells were collected at indicated time points for expression and mass spectrometry analyses. (K) Left: Immunoblots of Ucp1, Flag-ATF4, p-S6, total S6, p-4Ebp1, total 4Ebp1, puromycylated protein, ubiquitinated protein and Hsp90 in GFP or Cre-treated wild-type or Ucp1 KO BAs. Right: Relative abundance (to Hsp90) or phosphorylation (to total protein) shown. Significance between genotypes indicated. (L) Left: Immunoblots of Flag-ATF4, total ATF4, p-S6, total S6, p-4Ebp1, total 4Ebp1, puromycylated protein, ubiquitinated protein and Hsp90 in GFP or Cre-treated wild-type BAs after 4-hour treatment of 10 mM BCH or DMSO. Right: Relative abundance (to Hsp90) or phosphorylation (to total protein) shown. Significance between genotypes and treatment indicated. Data were presented as average ± SEM. Unpaired t-test. n.s.: non-significant; *: p<0.05 and **: p<0.01. (M) Box plot showing the fraction of heavy labeled over total protein in the GFP- or Cre-infected BAs in either wild-type (WT) or Ucp1 KO background at 6, 12, 24 hours post heavy medium switch. Welch’s 2-sided t-test performed. (N) Volcano plots showing the changes of H/L ratio between Cre- and GFP-infected BAs (X axis) and −log10 p value (Y axis) at 24-hour timepoint in WT and Ucp1 KO background. Grey box: proteins with higher turnover after ATF4-overexpression.

Journal: Cell reports

Article Title: Brown adipocyte ATF4 activation improves thermoregulation and systemic metabolism

doi: 10.1016/j.celrep.2021.109742

Figure Lengend Snippet: 3D rendering (A) and average values of 18F-Fluciclovine uptake (B) in ~10–12-week-old male CON and LrpprcBKO mice. White cycle: BAT. Sample size: CON (n=9) and LrpprcBKO (n=8). (C) Left: Immunoblots of p-S6, total S6, p-4Ebp1, total 4Ebp1, puromycylated protein, ubiquitinated protein and Hsp90 in the BAT of ~10-week-old male CON and ATF4BOX mice at ad libitum feeding at RT and 30°C. Right: Relative abundance (to Hsp90) or phosphorylation (to total protein) shown. Significance between genotypes indicated. (D) Core temperature drop of ~10-week-old male and female LrpprcBKO mice and their relative controls with pretreatment of DMSO, or 4mg kg−1 rapamycin (RAPA), or 0.625mg kg−1 bortezomib (BORT), or 50mg kg−1 BCH after 8 hours 4°C CTT from RT. Sample size: CON/RT/DMSO (n=9), LrpprcBKO/RT/DMSO (n=10), CON/RT/RAPA (n=6), LrpprcBKO/RT/RAPA (n=7), CON/RT/BORT (n=4), LrpprcBKO/RT/BORT (n=4), CON/RT/BCH (n=8) and LrpprcBKO/RT/BCH (n=5). (E) Core temperature drop of ~10-week-old male and female CON and ATF4BOX mice with pretreatment of DMSO or RAPA or BORT or BCH after 3 hours 4°C CTT from 30°C. Sample size: CON/30°C/DMSO (n=14), ATF4BOX/30°C/DMSO (n=14), CON/30°C/RAPA (n=5), ATF4BOX/30°C/RAPA (n=8), CON/30°C/BORT (n=5), ATF4BOX/30°C/BORT (n=7), CON/30°C/BCH (n=4) and ATF4BOX/30°C/BCH (n=9). (F) Core temperature drop of ~10-week-old male and female Ucp1 KO and ATF4BOX;Ucp1 KO mice with pretreatment of DMSO or RAPA or BORT or BCH after 3 hours 4°C CTT from RT. Sample size: Ucp1 KO/RT/DMSO (n=5), ATF4BOX;Ucp1 KO/RT/DMSO (n=3), Ucp1 KO/RT/RAPA (n=10), ATF4BOX;Ucp1 KO/RT/RAPA (n=5), Ucp1 KO/RT/BORT (n=4), ATF4BOX;Ucp1 KO/RT/BORT (n=4), Ucp1 KO/RT/BCH (n=5) and ATF4BOX;Ucp1 KO/RT/BCH (n=5). (G) The Temp (Neck-Back) of ~12-week-old male and female CON and LrpprcBKO mice 2 hours after injections of RAPA or BORT or DMSO at thermoneutrality. Sample size: CON (n=6) and LrpprcBKO (n=11). (H) The Temp (Neck-Back) of ~12-week-old male and female CON and ATF4BOX mice 2 hours after injections of RAPA or BORT or DMSO at thermoneutrality. Sample size: CON (n=7) and ATF4BOX (n=8). (I) The Temp (Neck-Back) of ~12-week-old male and female Ucp1 KO and ATF4BOX;Ucp1 KO mice 2 hours after injections of RAPA or BORT or DMSO at thermoneutrality. Sample size: Ucp1 KO (n=6) and ATF4BOX;Ucp1 KO (n=9). (J) Experimental setup of pSILAC in ATF4-expressing differentiated BAs. BAT SVF cells from ROSA-LSL-ATF4 or ROSA-LSL-ATF4;Ucp1 KO mice were cultured and differentiated in vitro. Four days after differentiation, GFP or Cre adenovirus were added at 100 MOI for two days. Cells were cultured in light medium from day 0 to 8, then transferred to heavy medium up to one day. Cells were collected at indicated time points for expression and mass spectrometry analyses. (K) Left: Immunoblots of Ucp1, Flag-ATF4, p-S6, total S6, p-4Ebp1, total 4Ebp1, puromycylated protein, ubiquitinated protein and Hsp90 in GFP or Cre-treated wild-type or Ucp1 KO BAs. Right: Relative abundance (to Hsp90) or phosphorylation (to total protein) shown. Significance between genotypes indicated. (L) Left: Immunoblots of Flag-ATF4, total ATF4, p-S6, total S6, p-4Ebp1, total 4Ebp1, puromycylated protein, ubiquitinated protein and Hsp90 in GFP or Cre-treated wild-type BAs after 4-hour treatment of 10 mM BCH or DMSO. Right: Relative abundance (to Hsp90) or phosphorylation (to total protein) shown. Significance between genotypes and treatment indicated. Data were presented as average ± SEM. Unpaired t-test. n.s.: non-significant; *: p<0.05 and **: p<0.01. (M) Box plot showing the fraction of heavy labeled over total protein in the GFP- or Cre-infected BAs in either wild-type (WT) or Ucp1 KO background at 6, 12, 24 hours post heavy medium switch. Welch’s 2-sided t-test performed. (N) Volcano plots showing the changes of H/L ratio between Cre- and GFP-infected BAs (X axis) and −log10 p value (Y axis) at 24-hour timepoint in WT and Ucp1 KO background. Grey box: proteins with higher turnover after ATF4-overexpression.

Article Snippet: For adenovirus infection at day 4, 50 MOI of Ad-GFP (#1060, Vector biolabs) or Ad-Cre (#1700, Vector biolabs) was incubated in differentiation media supplemented with 0.5 μg·mL −1 PLL (Poly-L-Lysine, #P2636, Sigma) for 5–10 min at room temperature.

Techniques: Western Blot, Expressing, Cell Culture, In Vitro, Mass Spectrometry, Labeling, Infection, Over Expression

KEY RESOURCES TABLE

Journal: Cell reports

Article Title: Brown adipocyte ATF4 activation improves thermoregulation and systemic metabolism

doi: 10.1016/j.celrep.2021.109742

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: For adenovirus infection at day 4, 50 MOI of Ad-GFP (#1060, Vector biolabs) or Ad-Cre (#1700, Vector biolabs) was incubated in differentiation media supplemented with 0.5 μg·mL −1 PLL (Poly-L-Lysine, #P2636, Sigma) for 5–10 min at room temperature.

Techniques: Plasmid Preparation, Recombinant, Enzyme-linked Immunosorbent Assay, Protein Quantitation, Mass Spectrometry, Software

(A) Live cell confocal images in SKBR3 cells expressing LCK-GCaMP at physiologic calcium (control) or treated with 10 mM extracellular calcium + 10 μM ionomycin. (B) Live cell confocal images in control and MAL2KD_SKBR3 cells expressing LCK-GCaMP. (C) Live cell confocal images in control and MβCD-treated SKBR3 cells expressing LCK-GCaM. (D) PMCA2 mRNA expression in control, MAL2KD-treated, or MβCD-treated SKBR3 cells as assessed by quantitative RT-PCR (n = 3). (E) Western blot analysis of PMCA2 protein levels in control, MAL2KD-treated, or MβCD-treated SKBR3 cells. (F) PLA with immunofluorescence for phalloidin in HER2 and PMCA2 in control (top row), MAL2KD-treated (middle row), and MβCD-treated (bottom row) SKBR3 cells. Scale bars represent 10 μm. (G) PLA for HER2 and GFP-PMCA2 with immunofluorescence for GFP-labeled PMCA2 and actin (phalloidin) in control (top row), MAL2KD-treated (middle row), and MβCD-treated (bottom row) SKBR3 cells. (H) Quantitation of PLA experiment from (F) and (G) by measuring the fluorescent intensity of amplified PLA reactions at the plasma membrane. (I) SIM imaging showing HER2- and GFP-labeled PMCA2 in control, MAL2KD-treated, and MβCD-treated SKBR3 cells. Scale bars represent 10 μm. (J) Apoptosis, as assessed by TUNEL assay, in MAL2KD cells relative to controls exposed to 5 mM calcium ± ionomycin. These results are the representative of three independent experiments.

Journal: Cell reports

Article Title: MAL2 mediates the formation of stable HER2 signaling complexes within lipid raft-rich membrane protrusions in breast cancer cells

doi: 10.1016/j.celrep.2021.110160

Figure Lengend Snippet: (A) Live cell confocal images in SKBR3 cells expressing LCK-GCaMP at physiologic calcium (control) or treated with 10 mM extracellular calcium + 10 μM ionomycin. (B) Live cell confocal images in control and MAL2KD_SKBR3 cells expressing LCK-GCaMP. (C) Live cell confocal images in control and MβCD-treated SKBR3 cells expressing LCK-GCaM. (D) PMCA2 mRNA expression in control, MAL2KD-treated, or MβCD-treated SKBR3 cells as assessed by quantitative RT-PCR (n = 3). (E) Western blot analysis of PMCA2 protein levels in control, MAL2KD-treated, or MβCD-treated SKBR3 cells. (F) PLA with immunofluorescence for phalloidin in HER2 and PMCA2 in control (top row), MAL2KD-treated (middle row), and MβCD-treated (bottom row) SKBR3 cells. Scale bars represent 10 μm. (G) PLA for HER2 and GFP-PMCA2 with immunofluorescence for GFP-labeled PMCA2 and actin (phalloidin) in control (top row), MAL2KD-treated (middle row), and MβCD-treated (bottom row) SKBR3 cells. (H) Quantitation of PLA experiment from (F) and (G) by measuring the fluorescent intensity of amplified PLA reactions at the plasma membrane. (I) SIM imaging showing HER2- and GFP-labeled PMCA2 in control, MAL2KD-treated, and MβCD-treated SKBR3 cells. Scale bars represent 10 μm. (J) Apoptosis, as assessed by TUNEL assay, in MAL2KD cells relative to controls exposed to 5 mM calcium ± ionomycin. These results are the representative of three independent experiments.

Article Snippet: Quantitative RT-PCR was performed with the SuperScript III Platinum One-Step qRT-PCR Kit (Invitrogen) using a Step One Plus Real-Time PCR System (Applied Biosystems) and the following TaqMan primer sets: flotillin1, Hs00195134_m1; MAL, Hs00707014_s1; MAL2, Hs01043579_u1; PMCA2, Hs01090447_m1; Ezrin, Hs00931646_m1; NHERF1, Hs00188594_m1.

Techniques: Expressing, Control, Quantitative RT-PCR, Western Blot, Immunofluorescence, Labeling, Quantitation Assay, Amplification, Clinical Proteomics, Membrane, Imaging, TUNEL Assay

(A) Immunofluorescence staining for cholera toxin B (lipid rafts) in control and trastuzumab-resistant SKBR3 cells. Scale bars represent 10 μm. (B) Immunofluorescence staining for HER2 and MAL2 in control and trastuzumab-resistant SKBR3 cells. Scale bars represent 10 μm. (C) PLA for HER2 and MAL2 in control and trastuzumab-resistant SKBR3 cells also stained for phalloidin. Scale bars represent 10 μm. (D–F) Quantitative results from immunoprecipitation coupled with data-independent acquisition mass spectrometry (DIA-MS) in control and trastuzumab-resistant SKBR3 cells. (D) The DIA-MS Intensity (log 2 ) of HER2 and MAL2 proteins from control and trastuzumab-resistant SKBR3 cells. (E) The DIA-MS Intensity (log 2 ) for all the peptide precursor signals of HER2 in control and resistant cells. (F) The DIA-MS peak groups visualized for quantifying HER2 (VLGSGAFGTVYK) and MAL2 (VTLPAGPDILR). Peaks above and below the middle line denote the MS2 and MS1 ion traces in DIA-MS. (G) MAL2, Ezrin, and NHERF1 mRNA expression in control and trastuzumab-resistant SKBR3 cells as assessed by quantitative RT-PCR (n = 3). (H) PLA for HER2 with Ezrin (left), NHERF1 (middle), and PMCA2 (right) in control and trastuzumab-resistant SKBR3 cells also stained for phalloidin. Boxed portions are amplified at right with co-registration of PLA signal and immunofluorescence for actin (phalloidin). (I) Quantitation of PLA experiment for HER2 in combination with MAL2, Ezrin, NHERF1, or PMCA2 represented as the fluorescent intensity of amplified PLA signals associated with membrane protrusions. (J) Coimmunoprecipitation for HER2 and HSP90 in control and trastuzumab-resistant SKBR3 cells. (K) PLA for HER2 and HSP90 in control and trastuzumab-resistant SKBR3 cells also stained for phalloidin. Scale bars represent 10 μm. (L) XTT cell viability assay in control, MAL2KD-treated, and MβCD-treated trastuzumab-resistant SKBR3 and BT474 cells. (M) Immunofluorescence staining for FOXO1 in control, MAL2KD-treated, and MβCD-treated trastuzumab-resistant SKBR3 cells. (N) Immunofluorescence staining for HER2 and pAKT in control, MAL2KD-treated, and MβCD-treated trastuzumab-resistant SKBR3 cells. Scale bars represent 10 μm. (O) Diagram representing the structure of MAL2- and lipid raft-enriched membrane protrusions containing multi-protein HER2 signaling complexes. These results are representative of three independent experiments.

Journal: Cell reports

Article Title: MAL2 mediates the formation of stable HER2 signaling complexes within lipid raft-rich membrane protrusions in breast cancer cells

doi: 10.1016/j.celrep.2021.110160

Figure Lengend Snippet: (A) Immunofluorescence staining for cholera toxin B (lipid rafts) in control and trastuzumab-resistant SKBR3 cells. Scale bars represent 10 μm. (B) Immunofluorescence staining for HER2 and MAL2 in control and trastuzumab-resistant SKBR3 cells. Scale bars represent 10 μm. (C) PLA for HER2 and MAL2 in control and trastuzumab-resistant SKBR3 cells also stained for phalloidin. Scale bars represent 10 μm. (D–F) Quantitative results from immunoprecipitation coupled with data-independent acquisition mass spectrometry (DIA-MS) in control and trastuzumab-resistant SKBR3 cells. (D) The DIA-MS Intensity (log 2 ) of HER2 and MAL2 proteins from control and trastuzumab-resistant SKBR3 cells. (E) The DIA-MS Intensity (log 2 ) for all the peptide precursor signals of HER2 in control and resistant cells. (F) The DIA-MS peak groups visualized for quantifying HER2 (VLGSGAFGTVYK) and MAL2 (VTLPAGPDILR). Peaks above and below the middle line denote the MS2 and MS1 ion traces in DIA-MS. (G) MAL2, Ezrin, and NHERF1 mRNA expression in control and trastuzumab-resistant SKBR3 cells as assessed by quantitative RT-PCR (n = 3). (H) PLA for HER2 with Ezrin (left), NHERF1 (middle), and PMCA2 (right) in control and trastuzumab-resistant SKBR3 cells also stained for phalloidin. Boxed portions are amplified at right with co-registration of PLA signal and immunofluorescence for actin (phalloidin). (I) Quantitation of PLA experiment for HER2 in combination with MAL2, Ezrin, NHERF1, or PMCA2 represented as the fluorescent intensity of amplified PLA signals associated with membrane protrusions. (J) Coimmunoprecipitation for HER2 and HSP90 in control and trastuzumab-resistant SKBR3 cells. (K) PLA for HER2 and HSP90 in control and trastuzumab-resistant SKBR3 cells also stained for phalloidin. Scale bars represent 10 μm. (L) XTT cell viability assay in control, MAL2KD-treated, and MβCD-treated trastuzumab-resistant SKBR3 and BT474 cells. (M) Immunofluorescence staining for FOXO1 in control, MAL2KD-treated, and MβCD-treated trastuzumab-resistant SKBR3 cells. (N) Immunofluorescence staining for HER2 and pAKT in control, MAL2KD-treated, and MβCD-treated trastuzumab-resistant SKBR3 cells. Scale bars represent 10 μm. (O) Diagram representing the structure of MAL2- and lipid raft-enriched membrane protrusions containing multi-protein HER2 signaling complexes. These results are representative of three independent experiments.

Article Snippet: Quantitative RT-PCR was performed with the SuperScript III Platinum One-Step qRT-PCR Kit (Invitrogen) using a Step One Plus Real-Time PCR System (Applied Biosystems) and the following TaqMan primer sets: flotillin1, Hs00195134_m1; MAL, Hs00707014_s1; MAL2, Hs01043579_u1; PMCA2, Hs01090447_m1; Ezrin, Hs00931646_m1; NHERF1, Hs00188594_m1.

Techniques: Immunofluorescence, Staining, Control, Immunoprecipitation, Data-independent acquisition, Mass Spectrometry, Expressing, Quantitative RT-PCR, Amplification, Quantitation Assay, Membrane, Viability Assay

Journal: iScience

Article Title: Transgenic modeling of Ndr2 gene amplification reveals disturbance of hippocampus circuitry and function

doi: 10.1016/j.isci.2021.102868

Figure Lengend Snippet:

Article Snippet: After washing with PB, sections were incubated with the biotin-coupled secondary antibody (1:250) in 2% BSA in PB for 2 h at room temperature followed by 1 h incubation at room temperature with Avidin-Biotin-Complex (Vectastain Elite ABC Kit, Vector Laboratories Inc., Bulingame, CA, USA).

Techniques: Recombinant, Staining, Immunostaining, Plasmid Preparation, Protein Concentration, Bradford Assay, Cell Isolation, Isolation, Mass Spectrometry, Transgenic Assay, Software

Immunosuppressive drugs alter the surface expression of high-mannose/hybrid N-glycans. Peripheral blood mononuclear cells were cultured for 6 days in the presence of CsA (200 ng per 1 mL medium), Rapa (20 ng per 1 mL medium), and the combination of CsA (150 ng per 1 mL medium) and Rapa (12 ng per 1 mL medium) in a two-way mixed leukocyte reaction (MLR). Immunosuppressive drug-treated and control cells were stained with biotinylated GNA (1 : 100), followed by incubation with FITC-conjugated ExtrAvidin. M2 region corresponds to GNA-positive leukocytes after allostimulation. Fluorescence was measured using a FACSCalibur flow cytometer (BD Biosciences). C: untreated cells, CsA: cyclosporin A, and Rapa: rapamycin.

Journal: Analytical Cellular Pathology (Amsterdam)

Article Title: Immunosuppressive Drugs Affect High-Mannose/Hybrid N-Glycans on Human Allostimulated Leukocytes

doi: 10.1155/2015/324980

Figure Lengend Snippet: Immunosuppressive drugs alter the surface expression of high-mannose/hybrid N-glycans. Peripheral blood mononuclear cells were cultured for 6 days in the presence of CsA (200 ng per 1 mL medium), Rapa (20 ng per 1 mL medium), and the combination of CsA (150 ng per 1 mL medium) and Rapa (12 ng per 1 mL medium) in a two-way mixed leukocyte reaction (MLR). Immunosuppressive drug-treated and control cells were stained with biotinylated GNA (1 : 100), followed by incubation with FITC-conjugated ExtrAvidin. M2 region corresponds to GNA-positive leukocytes after allostimulation. Fluorescence was measured using a FACSCalibur flow cytometer (BD Biosciences). C: untreated cells, CsA: cyclosporin A, and Rapa: rapamycin.

Article Snippet: Biotinylated Galanthus nivalis agglutinin (GNA, B-1246), agarose-bound GNA (AL-1243), agarose-bound streptavidin (SA-5010), and Carbo-Free Blocking Solution were obtained from Vector Lab.

Techniques: Expressing, Cell Culture, Staining, Incubation, Fluorescence, Flow Cytometry

Immunosuppressive drugs change the intensity of bands containing GNA-positive proteins. Peripheral blood mononuclear cells were cultured for 6 days in the presence of the combination of CsA (150 ng per 1 mL medium) and Rapa (12 ng per 1 mL medium) in a two-way mixed leukocyte reaction (MLR) and then lysed in RIPA buffer. Whole-cell lysate proteins (500 μ g) were precipitated with 25 μ L agarose-bound Galanthus nivalis lectin (GNA). The captured glycoproteins were recovered by boiling in Laemmli sample buffer with β -ME and resolved by 10% SDS-PAGE under reducing conditions. One-fifth of the GNA precipitate was destined for Western blotting (WB) and after probing with biotinylated-GNA was visualized by AP colorimetric reaction (a). The remaining four-fifths of the precipitate, after resolving on the same gel, were stained with Coomassie Brilliant Blue (CBB) and the bands were excised for MS/MS analysis (b). Molecular weight of proteins was assigned using a PageRuler Prestained Protein Ladder (Thermo Scientific, 26616). LP: lectin precipitation, C: untreated cells, CsA: cyclosporin A, and Rapa: rapamycin.

Journal: Analytical Cellular Pathology (Amsterdam)

Article Title: Immunosuppressive Drugs Affect High-Mannose/Hybrid N-Glycans on Human Allostimulated Leukocytes

doi: 10.1155/2015/324980

Figure Lengend Snippet: Immunosuppressive drugs change the intensity of bands containing GNA-positive proteins. Peripheral blood mononuclear cells were cultured for 6 days in the presence of the combination of CsA (150 ng per 1 mL medium) and Rapa (12 ng per 1 mL medium) in a two-way mixed leukocyte reaction (MLR) and then lysed in RIPA buffer. Whole-cell lysate proteins (500 μ g) were precipitated with 25 μ L agarose-bound Galanthus nivalis lectin (GNA). The captured glycoproteins were recovered by boiling in Laemmli sample buffer with β -ME and resolved by 10% SDS-PAGE under reducing conditions. One-fifth of the GNA precipitate was destined for Western blotting (WB) and after probing with biotinylated-GNA was visualized by AP colorimetric reaction (a). The remaining four-fifths of the precipitate, after resolving on the same gel, were stained with Coomassie Brilliant Blue (CBB) and the bands were excised for MS/MS analysis (b). Molecular weight of proteins was assigned using a PageRuler Prestained Protein Ladder (Thermo Scientific, 26616). LP: lectin precipitation, C: untreated cells, CsA: cyclosporin A, and Rapa: rapamycin.

Article Snippet: Biotinylated Galanthus nivalis agglutinin (GNA, B-1246), agarose-bound GNA (AL-1243), agarose-bound streptavidin (SA-5010), and Carbo-Free Blocking Solution were obtained from Vector Lab.

Techniques: Cell Culture, SDS Page, Western Blot, Staining, Tandem Mass Spectroscopy, Molecular Weight

sClever-1 is truncated at the C-terminus and released by serine protease activity. A-B , Electron microscopy images of immunogold labelling of Clever-1 in KG-1 cells showing outward membrane budding (A) and a tunneling nanotube-like structure (B) between two cells. Arrows point to gold particles. C-D , Western blot showing sClever-1 in conditioned media of PMA-differentiated KG-1 cells after 24 h inhibitor treatments: (E) bafilomycin (Baf), concanamycin (Con), GW4896 (GW), P1860, marimastat (Mari), untreated (Ctrl), bexmarilimab (Bex), and isotype control (hIgG4); (F) leupeptin (Leu), Bestatin (Bes), aprotinin (Apr), pepstatin A (Pep A), SID 26681509 (SID), CA-074 and E-64. E , Quantification (ELISA) of sClever-1 in vesicle fractions in KG-1 cell culture supernatant, blood and lymph separated by ultracentrifugation. Samples were normalized to 1 µg/µL of protein. The graphs represent one independent assay with three technical replicates. F , Western blot analysis of sClever-1 detected with 3-372 mouse anti-human Clever-1 antibody (parent of Bex) in vesicle and liquid fractions of plasma and cell culture supernatants of primary human macrophages (M0, no polarization; M1, IFNγ + LPS; M2, IL-4 + dexamethasone), endothelial cells (HLEC, human lymphatic endothelial cells; HPMEC, human pulmonary microvascular endothelial cells) and cell lines (KG-1 with/without PMA and HEK293). Equal loading of 10 µg of protein sample per lane was ensured by Qubit measurement of protein concentration. G , Western blot showing the abundance of a ~200 kDa sClever-1 species in healthy donors (n = 3) and MATINS patients (n = 4). # denotes the vesicle fraction. CD63 was used as a loading control. H , Mass spec analysis of Coomassie stained bands immunoprecipitated from human serum with Bex or 9-11 anti-Clever-1 antibodies and relative isotype controls hIgG4 and rIgG2a, respectively. The cartoons show Clever-1-specific peptide hits mapped to the full-length Clever-1 protein for Bex (orange) and 9-11 (magenta) pulldown. Venn diagrams depict shared peptides identified by Bex and 9-11.

Journal: Theranostics

Article Title: Secreted Clever-1 modulates T cell responses and impacts cancer immunotherapy efficacy

doi: 10.7150/thno.110544

Figure Lengend Snippet: sClever-1 is truncated at the C-terminus and released by serine protease activity. A-B , Electron microscopy images of immunogold labelling of Clever-1 in KG-1 cells showing outward membrane budding (A) and a tunneling nanotube-like structure (B) between two cells. Arrows point to gold particles. C-D , Western blot showing sClever-1 in conditioned media of PMA-differentiated KG-1 cells after 24 h inhibitor treatments: (E) bafilomycin (Baf), concanamycin (Con), GW4896 (GW), P1860, marimastat (Mari), untreated (Ctrl), bexmarilimab (Bex), and isotype control (hIgG4); (F) leupeptin (Leu), Bestatin (Bes), aprotinin (Apr), pepstatin A (Pep A), SID 26681509 (SID), CA-074 and E-64. E , Quantification (ELISA) of sClever-1 in vesicle fractions in KG-1 cell culture supernatant, blood and lymph separated by ultracentrifugation. Samples were normalized to 1 µg/µL of protein. The graphs represent one independent assay with three technical replicates. F , Western blot analysis of sClever-1 detected with 3-372 mouse anti-human Clever-1 antibody (parent of Bex) in vesicle and liquid fractions of plasma and cell culture supernatants of primary human macrophages (M0, no polarization; M1, IFNγ + LPS; M2, IL-4 + dexamethasone), endothelial cells (HLEC, human lymphatic endothelial cells; HPMEC, human pulmonary microvascular endothelial cells) and cell lines (KG-1 with/without PMA and HEK293). Equal loading of 10 µg of protein sample per lane was ensured by Qubit measurement of protein concentration. G , Western blot showing the abundance of a ~200 kDa sClever-1 species in healthy donors (n = 3) and MATINS patients (n = 4). # denotes the vesicle fraction. CD63 was used as a loading control. H , Mass spec analysis of Coomassie stained bands immunoprecipitated from human serum with Bex or 9-11 anti-Clever-1 antibodies and relative isotype controls hIgG4 and rIgG2a, respectively. The cartoons show Clever-1-specific peptide hits mapped to the full-length Clever-1 protein for Bex (orange) and 9-11 (magenta) pulldown. Venn diagrams depict shared peptides identified by Bex and 9-11.

Article Snippet: After H1 binding the aspirated cell pellets were resuspended in 0.5 mL ice-cold PBS premixed 50:50 with hypotonic Buffer A from a Minute Plasma Membrane Protein Isolation Kit (Invent Biotechnologies) to which 1 mM PMSF, 5 mM NaF, Roche cOmplete EDTA-free Protease Inhibitor Cocktail had been added.

Techniques: Activity Assay, Electron Microscopy, Membrane, Western Blot, Control, Enzyme-linked Immunosorbent Assay, Cell Culture, Clinical Proteomics, Protein Concentration, Mass Spectrometry, Staining, Immunoprecipitation